Mutagenetix > Incidental Mutations

Incidental Mutation 'R6925:Nfatc3'

541095

Institutional Source

Beutler Lab

Gene Symbol

Nfatc3

Ensembl Gene

ENSMUSG00000031902

Gene Name

nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 3

Synonyms

NFATx, NFAT4, D8Ertd281e

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6925 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

106058840-106130537 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 106119322 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1028 (D1028G)

Ref Sequence

ENSEMBL: ENSMUSP00000148556 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109308] [ENSMUST00000211991] [ENSMUST00000212742]

Predicted Effect

probably benign
Transcript: ENSMUST00000109308

SMART Domains

Protein: ENSMUSP00000104931
Gene: ENSMUSG00000031902

Domain	Start	End	E-Value	Type
low complexity region	153	182	N/A	INTRINSIC
low complexity region	205	225	N/A	INTRINSIC
low complexity region	257	271	N/A	INTRINSIC
low complexity region	286	305	N/A	INTRINSIC
Pfam:RHD_DNA_bind	434	593	4.9e-25	PFAM
IPT	600	699	1.19e-20	SMART
low complexity region	713	722	N/A	INTRINSIC
low complexity region	917	938	N/A	INTRINSIC
low complexity region	954	967	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000211991
AA Change: D1028G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

probably benign
Transcript: ENSMUST00000212742

Meta Mutation Damage Score

0.22

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.0%

Validation Efficiency

100% (91/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a member of the nuclear factors of activated T cells DNA-binding transcription complex. This complex consists of at least two components: a preexisting cytosolic component that translocates to the nucleus upon T cell receptor (TCR) stimulation and an inducible nuclear component. Other members of this family participate to form this complex also. The product of this gene plays a role in the regulation of gene expression in T cells and immature thymocytes. Several transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene experience some embryonic lethality and reduced body size. Developmental defects also exist in the immune system , skeletal muscle, vasculature, heart, and sensory nerves. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 90 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430419D17Rik	A	G	7: 131,222,707	Q177R	possibly damaging	Het
Acat1	A	T	9: 53,592,029	V170E	probably benign	Het
Atp2b2	T	A	6: 113,760,720	I902F	probably damaging	Het
Cacna1d	A	G	14: 30,051,637	V1697A	probably benign	Het
Ccdc14	T	A	16: 34,690,749	F31Y	probably benign	Het
Ccdc17	T	A	4: 116,598,210	V250E	probably damaging	Het
Cct7	A	G	6: 85,459,182	N25S	probably damaging	Het
Cep19	G	C	16: 32,103,942	G9R	probably damaging	Het
Ces5a	A	T	8: 93,523,057		probably null	Het
Chd1l	T	G	3: 97,582,826	E471A	probably damaging	Het
Chd6	A	G	2: 161,013,127	I787T	probably damaging	Het
Cntnap5c	A	C	17: 58,395,266	T1194P	probably benign	Het
Col6a3	T	A	1: 90,816,002	M208L	probably benign	Het
Coro7	A	T	16: 4,628,674		probably null	Het
Csrnp2	T	C	15: 100,481,958	K484R	probably benign	Het
Cyp2c39	T	A	19: 39,513,195	V64E	probably damaging	Het
Ddr2	T	C	1: 169,998,132	K300E	probably benign	Het
Ddx56	T	C	11: 6,263,980	E393G	probably damaging	Het
Diaph1	A	C	18: 37,853,679	Y1084*	probably null	Het
Disp1	A	T	1: 183,086,478	F1459L	probably benign	Het
Dnajc8	G	A	4: 132,544,113	A80T	probably damaging	Het
Elfn1	T	A	5: 139,971,685	M148K	probably benign	Het
Emcn	T	A	3: 137,419,002	I154N	probably damaging	Het
Enah	C	G	1: 181,905,898		probably null	Het
Enah	T	A	1: 181,905,899		probably null	Het
Ep300	C	A	15: 81,649,981	Q2080K	probably benign	Het
Epha2	T	A	4: 141,308,757	M168K	probably benign	Het
Ercc6	T	A	14: 32,562,608	I776N	probably damaging	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fat4	G	T	3: 38,996,204		probably null	Het
G3bp1	A	G	11: 55,497,960	R333G	possibly damaging	Het
Gm3604	A	G	13: 62,369,390	F385L	probably benign	Het
Gm5800	T	C	14: 51,713,700	I147M	possibly damaging	Het
Hipk1	A	G	3: 103,778,245	F18S	unknown	Het
Ighv3-8	A	T	12: 114,322,330	C131S	probably benign	Het
Il23r	T	G	6: 67,423,493	T618P	probably damaging	Het
Il31ra	G	A	13: 112,527,529	T538I	possibly damaging	Het
Kcns2	A	G	15: 34,839,913	D474G	unknown	Het
Klc4	T	C	17: 46,636,229	T407A	possibly damaging	Het
Klra5	C	T	6: 129,911,457	S2N	probably benign	Het
Krt10	T	C	11: 99,388,851	Y161C	probably damaging	Het
Kxd1	A	T	8: 70,523,278	M1K	probably null	Het
Lgals1	A	C	15: 78,928,040	D27A	possibly damaging	Het
Lgr5	T	C	10: 115,466,346	S308G	probably benign	Het
Lrp1	G	A	10: 127,556,988	S2736L	probably benign	Het
Lrpap1	G	T	5: 35,102,536	H73N	probably benign	Het
Mcpt1	C	A	14: 56,019,065	T86K	probably damaging	Het
Megf6	A	T	4: 154,254,587	D527V	probably damaging	Het
Mical3	A	T	6: 120,959,390	S1392T	probably benign	Het
Mmp2	A	T	8: 92,839,382	D437V	probably damaging	Het
Mob4	T	A	1: 55,152,722	Y166*	probably null	Het
Mrap2	G	A	9: 87,182,474	M89I	possibly damaging	Het
Mug1	G	A	6: 121,881,787	A1155T	probably damaging	Het
Myh2	G	T	11: 67,193,218	A1556S	probably benign	Het
Ngef	T	G	1: 87,503,263		probably null	Het
Nlrp1a	A	T	11: 71,092,513	L1209Q	probably null	Het
Npr2	C	T	4: 43,647,553	R819C	probably damaging	Het
Nsd2	A	T	5: 33,879,110	D646V	probably damaging	Het
Nsun7	A	G	5: 66,277,072	H252R	probably damaging	Het
Olfr267	A	T	4: 58,785,647	I25N	possibly damaging	Het
Olfr447	T	A	6: 42,911,857	C111*	probably null	Het
Olfr642	C	T	7: 104,049,740	V205I	probably benign	Het
Olfr951	A	T	9: 39,393,860	Q20L	probably benign	Het
Olfr951	G	T	9: 39,393,861	Q20H	probably benign	Het
Pcdhga2	A	T	18: 37,670,585	D494V	probably damaging	Het
Pcsk2	A	G	2: 143,813,747	E617G	probably damaging	Het
Pdc	T	C	1: 150,333,180	I138T	probably damaging	Het
Phc2	T	A	4: 128,748,134	S750T	probably damaging	Het
Pkd2l1	T	A	19: 44,191,508	N88Y	possibly damaging	Het
Plcl1	C	T	1: 55,406,598	R71*	probably null	Het
Prag1	C	A	8: 36,103,894	L544M	probably damaging	Het
Prkg2	A	G	5: 98,966,510		probably null	Het
Psd2	G	A	18: 35,979,711	S153N	probably damaging	Het
Rab11fip1	A	T	8: 27,152,972	S600T	probably damaging	Het
Rbms1	T	G	2: 60,762,304	T222P	probably benign	Het
Slfn8	A	T	11: 83,013,417	Y382*	probably null	Het
Socs4	T	A	14: 47,289,738	C43*	probably null	Het
Sorl1	T	A	9: 42,033,626	T868S	probably damaging	Het
St6gal1	A	G	16: 23,356,213	Y267C	probably damaging	Het
Syne1	A	G	10: 5,126,682	V6879A	probably benign	Het
Syne2	C	A	12: 75,854,132	H22N	possibly damaging	Het
Tmeff2	T	A	1: 50,928,021	L25Q	probably damaging	Het
Tmprss11g	G	T	5: 86,487,426	D396E	probably benign	Het
Tmprss11g	T	A	5: 86,487,436	H393L	probably benign	Het
Vmn2r23	A	G	6: 123,704,553	E140G	probably damaging	Het
Wapl	T	C	14: 34,677,363	S130P	probably benign	Het
Zeb2	T	A	2: 44,994,529	K982M	probably damaging	Het
Zfhx3	C	G	8: 108,956,821	H3631D	unknown	Het
Zfp719	T	C	7: 43,590,706	S573P	probably damaging	Het
Zfp979	A	T	4: 147,613,542	C237S	possibly damaging	Het

Other mutations in Nfatc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00885:Nfatc3	APN	8	106099177	missense	probably damaging	1.00
IGL01755:Nfatc3	APN	8	106127921	missense	probably benign	0.42
IGL02314:Nfatc3	APN	8	106078900	missense	probably benign	0.21
IGL02724:Nfatc3	APN	8	106108185	missense	probably benign	0.29
Struggles	UTSW	8	106083870	nonsense	probably null
PIT1430001:Nfatc3	UTSW	8	106059973	missense	possibly damaging	0.78
PIT4515001:Nfatc3	UTSW	8	106079203	missense	possibly damaging	0.94
R0088:Nfatc3	UTSW	8	106127942	missense	possibly damaging	0.90
R0348:Nfatc3	UTSW	8	106092195	missense	probably damaging	1.00
R0410:Nfatc3	UTSW	8	106096196	missense	probably damaging	1.00
R1509:Nfatc3	UTSW	8	106083854	missense	possibly damaging	0.46
R1702:Nfatc3	UTSW	8	106092160	missense	probably damaging	1.00
R1735:Nfatc3	UTSW	8	106083834	missense	probably damaging	1.00
R1736:Nfatc3	UTSW	8	106078850	missense	probably damaging	1.00
R1758:Nfatc3	UTSW	8	106099136	missense	probably damaging	1.00
R2370:Nfatc3	UTSW	8	106108455	missense	probably damaging	1.00
R2878:Nfatc3	UTSW	8	106092144	missense	probably damaging	1.00
R3802:Nfatc3	UTSW	8	106079645	missense	probably damaging	0.99
R3959:Nfatc3	UTSW	8	106099077	nonsense	probably null
R4006:Nfatc3	UTSW	8	106108839	missense	probably benign	0.00
R4079:Nfatc3	UTSW	8	106079491	missense	probably damaging	0.98
R4589:Nfatc3	UTSW	8	106079073	missense	probably damaging	1.00
R4818:Nfatc3	UTSW	8	106108379	missense	probably benign	0.00
R4907:Nfatc3	UTSW	8	106079727	missense	probably damaging	1.00
R5042:Nfatc3	UTSW	8	106108125	missense	probably benign	0.25
R5632:Nfatc3	UTSW	8	106079057	missense	probably damaging	1.00
R5741:Nfatc3	UTSW	8	106079066	missense	probably damaging	1.00
R5885:Nfatc3	UTSW	8	106096312	missense	probably benign	0.00
R6439:Nfatc3	UTSW	8	106083870	nonsense	probably null
R6557:Nfatc3	UTSW	8	106119354	missense	probably benign	0.01
R6737:Nfatc3	UTSW	8	106083969	missense	probably damaging	1.00
R7260:Nfatc3	UTSW	8	106108946	missense	probably benign	0.00
R7429:Nfatc3	UTSW	8	106108403	missense	probably benign	0.00
R7430:Nfatc3	UTSW	8	106108403	missense	probably benign	0.00
R7526:Nfatc3	UTSW	8	106079083	missense	probably damaging	1.00
X0063:Nfatc3	UTSW	8	106083939	missense	probably damaging	1.00
X0064:Nfatc3	UTSW	8	106108349	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- TCTTACAGGTCAGAGGAACTTCTTTTC -3'
(R):5'- AGCCATGGCATGCAAATACC -3'

Sequencing Primer
(F):5'- TTCCAGGACAGTCAAGGCTTTACAG -3'
(R):5'- GGCATGCAAATACCAGACTAGTGTAC -3'

Posted On

2018-11-28