Incidental Mutation 'R6925:Olfr951'
ID541098
Institutional Source Beutler Lab
Gene Symbol Olfr951
Ensembl Gene ENSMUSG00000094269
Gene Nameolfactory receptor 951
SynonymsMOR171-49, MOR171-33P, GA_x6K02T2PVTD-33090395-33091330
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R6925 (G1)
Quality Score220.009
Status Validated
Chromosome9
Chromosomal Location39387410-39395633 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 39393861 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 20 (Q20H)
Ref Sequence ENSEMBL: ENSMUSP00000150976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078531] [ENSMUST00000216107]
Predicted Effect probably benign
Transcript: ENSMUST00000078531
AA Change: Q23H

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000077615
Gene: ENSMUSG00000094269
AA Change: Q23H

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 2.5e-52 PFAM
Pfam:7tm_1 44 293 5e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216107
AA Change: Q20H

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A G 7: 131,222,707 Q177R possibly damaging Het
Acat1 A T 9: 53,592,029 V170E probably benign Het
Atp2b2 T A 6: 113,760,720 I902F probably damaging Het
Cacna1d A G 14: 30,051,637 V1697A probably benign Het
Ccdc14 T A 16: 34,690,749 F31Y probably benign Het
Ccdc17 T A 4: 116,598,210 V250E probably damaging Het
Cct7 A G 6: 85,459,182 N25S probably damaging Het
Cep19 G C 16: 32,103,942 G9R probably damaging Het
Ces5a A T 8: 93,523,057 probably null Het
Chd1l T G 3: 97,582,826 E471A probably damaging Het
Chd6 A G 2: 161,013,127 I787T probably damaging Het
Cntnap5c A C 17: 58,395,266 T1194P probably benign Het
Col6a3 T A 1: 90,816,002 M208L probably benign Het
Coro7 A T 16: 4,628,674 probably null Het
Csrnp2 T C 15: 100,481,958 K484R probably benign Het
Cyp2c39 T A 19: 39,513,195 V64E probably damaging Het
Ddr2 T C 1: 169,998,132 K300E probably benign Het
Ddx56 T C 11: 6,263,980 E393G probably damaging Het
Diaph1 A C 18: 37,853,679 Y1084* probably null Het
Disp1 A T 1: 183,086,478 F1459L probably benign Het
Dnajc8 G A 4: 132,544,113 A80T probably damaging Het
Elfn1 T A 5: 139,971,685 M148K probably benign Het
Emcn T A 3: 137,419,002 I154N probably damaging Het
Enah C G 1: 181,905,898 probably null Het
Enah T A 1: 181,905,899 probably null Het
Ep300 C A 15: 81,649,981 Q2080K probably benign Het
Epha2 T A 4: 141,308,757 M168K probably benign Het
Ercc6 T A 14: 32,562,608 I776N probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat4 G T 3: 38,996,204 probably null Het
G3bp1 A G 11: 55,497,960 R333G possibly damaging Het
Gm3604 A G 13: 62,369,390 F385L probably benign Het
Gm5800 T C 14: 51,713,700 I147M possibly damaging Het
Hipk1 A G 3: 103,778,245 F18S unknown Het
Ighv3-8 A T 12: 114,322,330 C131S probably benign Het
Il23r T G 6: 67,423,493 T618P probably damaging Het
Il31ra G A 13: 112,527,529 T538I possibly damaging Het
Kcns2 A G 15: 34,839,913 D474G unknown Het
Klc4 T C 17: 46,636,229 T407A possibly damaging Het
Klra5 C T 6: 129,911,457 S2N probably benign Het
Krt10 T C 11: 99,388,851 Y161C probably damaging Het
Kxd1 A T 8: 70,523,278 M1K probably null Het
Lgals1 A C 15: 78,928,040 D27A possibly damaging Het
Lgr5 T C 10: 115,466,346 S308G probably benign Het
Lrp1 G A 10: 127,556,988 S2736L probably benign Het
Lrpap1 G T 5: 35,102,536 H73N probably benign Het
Mcpt1 C A 14: 56,019,065 T86K probably damaging Het
Megf6 A T 4: 154,254,587 D527V probably damaging Het
Mical3 A T 6: 120,959,390 S1392T probably benign Het
Mmp2 A T 8: 92,839,382 D437V probably damaging Het
Mob4 T A 1: 55,152,722 Y166* probably null Het
Mrap2 G A 9: 87,182,474 M89I possibly damaging Het
Mug1 G A 6: 121,881,787 A1155T probably damaging Het
Myh2 G T 11: 67,193,218 A1556S probably benign Het
Nfatc3 A G 8: 106,119,322 D1028G probably benign Het
Ngef T G 1: 87,503,263 probably null Het
Nlrp1a A T 11: 71,092,513 L1209Q probably null Het
Npr2 C T 4: 43,647,553 R819C probably damaging Het
Nsd2 A T 5: 33,879,110 D646V probably damaging Het
Nsun7 A G 5: 66,277,072 H252R probably damaging Het
Olfr267 A T 4: 58,785,647 I25N possibly damaging Het
Olfr447 T A 6: 42,911,857 C111* probably null Het
Olfr642 C T 7: 104,049,740 V205I probably benign Het
Pcdhga2 A T 18: 37,670,585 D494V probably damaging Het
Pcsk2 A G 2: 143,813,747 E617G probably damaging Het
Pdc T C 1: 150,333,180 I138T probably damaging Het
Phc2 T A 4: 128,748,134 S750T probably damaging Het
Pkd2l1 T A 19: 44,191,508 N88Y possibly damaging Het
Plcl1 C T 1: 55,406,598 R71* probably null Het
Prag1 C A 8: 36,103,894 L544M probably damaging Het
Prkg2 A G 5: 98,966,510 probably null Het
Psd2 G A 18: 35,979,711 S153N probably damaging Het
Rab11fip1 A T 8: 27,152,972 S600T probably damaging Het
Rbms1 T G 2: 60,762,304 T222P probably benign Het
Slfn8 A T 11: 83,013,417 Y382* probably null Het
Socs4 T A 14: 47,289,738 C43* probably null Het
Sorl1 T A 9: 42,033,626 T868S probably damaging Het
St6gal1 A G 16: 23,356,213 Y267C probably damaging Het
Syne1 A G 10: 5,126,682 V6879A probably benign Het
Syne2 C A 12: 75,854,132 H22N possibly damaging Het
Tmeff2 T A 1: 50,928,021 L25Q probably damaging Het
Tmprss11g G T 5: 86,487,426 D396E probably benign Het
Tmprss11g T A 5: 86,487,436 H393L probably benign Het
Vmn2r23 A G 6: 123,704,553 E140G probably damaging Het
Wapl T C 14: 34,677,363 S130P probably benign Het
Zeb2 T A 2: 44,994,529 K982M probably damaging Het
Zfhx3 C G 8: 108,956,821 H3631D unknown Het
Zfp719 T C 7: 43,590,706 S573P probably damaging Het
Zfp979 A T 4: 147,613,542 C237S possibly damaging Het
Other mutations in Olfr951
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01527:Olfr951 APN 9 39393818 missense probably benign 0.01
IGL01650:Olfr951 APN 9 39393956 missense probably damaging 0.99
IGL02134:Olfr951 APN 9 39394534 missense probably damaging 0.99
IGL03113:Olfr951 APN 9 39394685 missense probably damaging 1.00
R0127:Olfr951 UTSW 9 39393942 missense probably benign 0.16
R1730:Olfr951 UTSW 9 39394222 missense probably benign 0.01
R1783:Olfr951 UTSW 9 39394222 missense probably benign 0.01
R1924:Olfr951 UTSW 9 39393867 missense possibly damaging 0.93
R3785:Olfr951 UTSW 9 39394382 missense probably benign 0.07
R3787:Olfr951 UTSW 9 39394382 missense probably benign 0.07
R4607:Olfr951 UTSW 9 39394735 makesense probably null
R4803:Olfr951 UTSW 9 39394636 missense probably benign 0.26
R5314:Olfr951 UTSW 9 39394489 missense probably damaging 1.00
R5338:Olfr951 UTSW 9 39394075 missense probably damaging 1.00
R5360:Olfr951 UTSW 9 39394402 missense probably benign 0.00
R5468:Olfr951 UTSW 9 39393961 missense probably benign 0.33
R6590:Olfr951 UTSW 9 39394549 missense probably benign 0.00
R6690:Olfr951 UTSW 9 39394549 missense probably benign 0.00
R6925:Olfr951 UTSW 9 39393860 missense probably benign 0.32
R6982:Olfr951 UTSW 9 39394322 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTCAACACAGGCACTTTC -3'
(R):5'- GGTAACAACTGTGGACTGACC -3'

Sequencing Primer
(F):5'- GGCACTTTCACTCACTAATACAG -3'
(R):5'- CAAAGTCAATGAAGGACAAACTGCTG -3'
Posted On2018-11-28