Incidental Mutation 'R6925:Ddx56'
ID 541105
Institutional Source Beutler Lab
Gene Symbol Ddx56
Ensembl Gene ENSMUSG00000004393
Gene Name DEAD (Asp-Glu-Ala-Asp) box polypeptide 56
Synonyms NOH61, D11Ertd619e, 2600001H07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock # R6925 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 6258919-6267772 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 6263980 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 393 (E393G)
Ref Sequence ENSEMBL: ENSMUSP00000004507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004507] [ENSMUST00000151446]
AlphaFold Q9D0R4
Predicted Effect probably damaging
Transcript: ENSMUST00000004507
AA Change: E393G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000004507
Gene: ENSMUSG00000004393
AA Change: E393G

DomainStartEndE-ValueType
DEXDc 26 234 4.13e-46 SMART
low complexity region 246 256 N/A INTRINSIC
HELICc 272 380 2.42e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151446
SMART Domains Protein: ENSMUSP00000122368
Gene: ENSMUSG00000004393

DomainStartEndE-ValueType
DEXDc 26 216 3.65e-38 SMART
low complexity region 228 236 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAD box protein family. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The protein encoded by this gene shows ATPase activity in the presence of polynucleotides and associates with nucleoplasmic 65S preribosomal particles. This gene may be involved in ribosome synthesis, most likely during assembly of the large 60S ribosomal subunit. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A G 7: 131,222,707 Q177R possibly damaging Het
Acat1 A T 9: 53,592,029 V170E probably benign Het
Atp2b2 T A 6: 113,760,720 I902F probably damaging Het
Cacna1d A G 14: 30,051,637 V1697A probably benign Het
Ccdc14 T A 16: 34,690,749 F31Y probably benign Het
Ccdc17 T A 4: 116,598,210 V250E probably damaging Het
Cct7 A G 6: 85,459,182 N25S probably damaging Het
Cep19 G C 16: 32,103,942 G9R probably damaging Het
Ces5a A T 8: 93,523,057 probably null Het
Chd1l T G 3: 97,582,826 E471A probably damaging Het
Chd6 A G 2: 161,013,127 I787T probably damaging Het
Cntnap5c A C 17: 58,395,266 T1194P probably benign Het
Col6a3 T A 1: 90,816,002 M208L probably benign Het
Coro7 A T 16: 4,628,674 probably null Het
Csrnp2 T C 15: 100,481,958 K484R probably benign Het
Cyp2c39 T A 19: 39,513,195 V64E probably damaging Het
Ddr2 T C 1: 169,998,132 K300E probably benign Het
Diaph1 A C 18: 37,853,679 Y1084* probably null Het
Disp1 A T 1: 183,086,478 F1459L probably benign Het
Dnajc8 G A 4: 132,544,113 A80T probably damaging Het
Elfn1 T A 5: 139,971,685 M148K probably benign Het
Emcn T A 3: 137,419,002 I154N probably damaging Het
Enah C G 1: 181,905,898 probably null Het
Enah T A 1: 181,905,899 probably null Het
Ep300 C A 15: 81,649,981 Q2080K probably benign Het
Epha2 T A 4: 141,308,757 M168K probably benign Het
Ercc6 T A 14: 32,562,608 I776N probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat4 G T 3: 38,996,204 probably null Het
G3bp1 A G 11: 55,497,960 R333G possibly damaging Het
Gm3604 A G 13: 62,369,390 F385L probably benign Het
Gm5800 T C 14: 51,713,700 I147M possibly damaging Het
Hipk1 A G 3: 103,778,245 F18S unknown Het
Ighv3-8 A T 12: 114,322,330 C131S probably benign Het
Il23r T G 6: 67,423,493 T618P probably damaging Het
Il31ra G A 13: 112,527,529 T538I possibly damaging Het
Kcns2 A G 15: 34,839,913 D474G unknown Het
Klc4 T C 17: 46,636,229 T407A possibly damaging Het
Klra5 C T 6: 129,911,457 S2N probably benign Het
Krt10 T C 11: 99,388,851 Y161C probably damaging Het
Kxd1 A T 8: 70,523,278 M1K probably null Het
Lgals1 A C 15: 78,928,040 D27A possibly damaging Het
Lgr5 T C 10: 115,466,346 S308G probably benign Het
Lrp1 G A 10: 127,556,988 S2736L probably benign Het
Lrpap1 G T 5: 35,102,536 H73N probably benign Het
Mcpt1 C A 14: 56,019,065 T86K probably damaging Het
Megf6 A T 4: 154,254,587 D527V probably damaging Het
Mical3 A T 6: 120,959,390 S1392T probably benign Het
Mmp2 A T 8: 92,839,382 D437V probably damaging Het
Mob4 T A 1: 55,152,722 Y166* probably null Het
Mrap2 G A 9: 87,182,474 M89I possibly damaging Het
Mug1 G A 6: 121,881,787 A1155T probably damaging Het
Myh2 G T 11: 67,193,218 A1556S probably benign Het
Nfatc3 A G 8: 106,119,322 D1028G probably benign Het
Ngef T G 1: 87,503,263 probably null Het
Nlrp1a A T 11: 71,092,513 L1209Q probably null Het
Npr2 C T 4: 43,647,553 R819C probably damaging Het
Nsd2 A T 5: 33,879,110 D646V probably damaging Het
Nsun7 A G 5: 66,277,072 H252R probably damaging Het
Olfr267 A T 4: 58,785,647 I25N possibly damaging Het
Olfr447 T A 6: 42,911,857 C111* probably null Het
Olfr642 C T 7: 104,049,740 V205I probably benign Het
Olfr951 A T 9: 39,393,860 Q20L probably benign Het
Olfr951 G T 9: 39,393,861 Q20H probably benign Het
Pcdhga2 A T 18: 37,670,585 D494V probably damaging Het
Pcsk2 A G 2: 143,813,747 E617G probably damaging Het
Pdc T C 1: 150,333,180 I138T probably damaging Het
Phc2 T A 4: 128,748,134 S750T probably damaging Het
Pkd2l1 T A 19: 44,191,508 N88Y possibly damaging Het
Plcl1 C T 1: 55,406,598 R71* probably null Het
Prag1 C A 8: 36,103,894 L544M probably damaging Het
Prkg2 A G 5: 98,966,510 probably null Het
Psd2 G A 18: 35,979,711 S153N probably damaging Het
Rab11fip1 A T 8: 27,152,972 S600T probably damaging Het
Rbms1 T G 2: 60,762,304 T222P probably benign Het
Slfn8 A T 11: 83,013,417 Y382* probably null Het
Socs4 T A 14: 47,289,738 C43* probably null Het
Sorl1 T A 9: 42,033,626 T868S probably damaging Het
St6gal1 A G 16: 23,356,213 Y267C probably damaging Het
Syne1 A G 10: 5,126,682 V6879A probably benign Het
Syne2 C A 12: 75,854,132 H22N possibly damaging Het
Tmeff2 T A 1: 50,928,021 L25Q probably damaging Het
Tmprss11g G T 5: 86,487,426 D396E probably benign Het
Tmprss11g T A 5: 86,487,436 H393L probably benign Het
Vmn2r23 A G 6: 123,704,553 E140G probably damaging Het
Wapl T C 14: 34,677,363 S130P probably benign Het
Zeb2 T A 2: 44,994,529 K982M probably damaging Het
Zfhx3 C G 8: 108,956,821 H3631D unknown Het
Zfp719 T C 7: 43,590,706 S573P probably damaging Het
Zfp979 A T 4: 147,613,542 C237S possibly damaging Het
Other mutations in Ddx56
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01061:Ddx56 APN 11 6264671 splice site probably null
IGL01764:Ddx56 APN 11 6265692 missense probably null 0.05
IGL02858:Ddx56 APN 11 6267667 missense probably damaging 0.99
IGL03075:Ddx56 APN 11 6261632 missense probably benign 0.00
R0972:Ddx56 UTSW 11 6267718 start codon destroyed probably null 0.99
R1652:Ddx56 UTSW 11 6267679 missense probably damaging 1.00
R1744:Ddx56 UTSW 11 6266396 missense probably damaging 1.00
R1793:Ddx56 UTSW 11 6266934 missense probably damaging 0.99
R1869:Ddx56 UTSW 11 6263993 missense possibly damaging 0.88
R1917:Ddx56 UTSW 11 6263937 critical splice donor site probably null
R2415:Ddx56 UTSW 11 6261727 unclassified probably benign
R3839:Ddx56 UTSW 11 6267712 missense probably benign 0.23
R4445:Ddx56 UTSW 11 6265770 splice site probably null
R5041:Ddx56 UTSW 11 6264178 missense probably damaging 1.00
R7412:Ddx56 UTSW 11 6261720 missense probably damaging 0.99
R8401:Ddx56 UTSW 11 6264199 missense probably damaging 1.00
R9088:Ddx56 UTSW 11 6259612 missense probably benign 0.00
R9382:Ddx56 UTSW 11 6265516 missense probably damaging 1.00
Z1177:Ddx56 UTSW 11 6267445 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGTTCAGCCACAGATCAAC -3'
(R):5'- GCTTATGTCCATCGAGCTGG -3'

Sequencing Primer
(F):5'- GCCTAGCCTCAAACTGTCAGTC -3'
(R):5'- TCCATCGAGCTGGCAGGTAG -3'
Posted On 2018-11-28