Incidental Mutation 'R6925:Coro7'
ID 541125
Institutional Source Beutler Lab
Gene Symbol Coro7
Ensembl Gene ENSMUSG00000039637
Gene Name coronin 7
Synonyms 0610011B16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock # R6925 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 4626133-4679777 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 4628674 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000048489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014445] [ENSMUST00000038552] [ENSMUST00000135823] [ENSMUST00000156889]
AlphaFold Q9D2V7
Predicted Effect probably benign
Transcript: ENSMUST00000014445
SMART Domains Protein: ENSMUSP00000014445
Gene: ENSMUSG00000014301

DomainStartEndE-ValueType
Pfam:Pam16 1 125 4.9e-63 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000038552
SMART Domains Protein: ENSMUSP00000048489
Gene: ENSMUSG00000039637

DomainStartEndE-ValueType
DUF1899 3 64 6.41e-15 SMART
WD40 66 106 1.83e-7 SMART
WD40 115 154 4.13e0 SMART
WD40 157 196 1.78e-5 SMART
DUF1900 251 385 4.49e-60 SMART
low complexity region 427 456 N/A INTRINSIC
DUF1899 463 528 1.2e-19 SMART
WD40 531 570 3.64e-2 SMART
WD40 580 620 8.55e-8 SMART
WD40 623 662 1.16e-9 SMART
low complexity region 667 679 N/A INTRINSIC
DUF1900 718 854 6.69e-68 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135823
SMART Domains Protein: ENSMUSP00000118310
Gene: ENSMUSG00000039637

DomainStartEndE-ValueType
DUF1899 3 64 6.41e-15 SMART
WD40 66 106 1.83e-7 SMART
WD40 115 154 4.13e0 SMART
WD40 157 196 1.78e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156889
Meta Mutation Damage Score 0.9577 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (91/91)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal but exhibit disruption of the Golgi apparatus. Mutant fibroblasts show increased cell spreading and cellular F-actin content, increased cell polarization and migration, and enhanced wound healing in a scratch-wound assay. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A G 7: 131,222,707 Q177R possibly damaging Het
Acat1 A T 9: 53,592,029 V170E probably benign Het
Atp2b2 T A 6: 113,760,720 I902F probably damaging Het
Cacna1d A G 14: 30,051,637 V1697A probably benign Het
Ccdc14 T A 16: 34,690,749 F31Y probably benign Het
Ccdc17 T A 4: 116,598,210 V250E probably damaging Het
Cct7 A G 6: 85,459,182 N25S probably damaging Het
Cep19 G C 16: 32,103,942 G9R probably damaging Het
Ces5a A T 8: 93,523,057 probably null Het
Chd1l T G 3: 97,582,826 E471A probably damaging Het
Chd6 A G 2: 161,013,127 I787T probably damaging Het
Cntnap5c A C 17: 58,395,266 T1194P probably benign Het
Col6a3 T A 1: 90,816,002 M208L probably benign Het
Csrnp2 T C 15: 100,481,958 K484R probably benign Het
Cyp2c39 T A 19: 39,513,195 V64E probably damaging Het
Ddr2 T C 1: 169,998,132 K300E probably benign Het
Ddx56 T C 11: 6,263,980 E393G probably damaging Het
Diaph1 A C 18: 37,853,679 Y1084* probably null Het
Disp1 A T 1: 183,086,478 F1459L probably benign Het
Dnajc8 G A 4: 132,544,113 A80T probably damaging Het
Elfn1 T A 5: 139,971,685 M148K probably benign Het
Emcn T A 3: 137,419,002 I154N probably damaging Het
Enah C G 1: 181,905,898 probably null Het
Enah T A 1: 181,905,899 probably null Het
Ep300 C A 15: 81,649,981 Q2080K probably benign Het
Epha2 T A 4: 141,308,757 M168K probably benign Het
Ercc6 T A 14: 32,562,608 I776N probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat4 G T 3: 38,996,204 probably null Het
G3bp1 A G 11: 55,497,960 R333G possibly damaging Het
Gm3604 A G 13: 62,369,390 F385L probably benign Het
Gm5800 T C 14: 51,713,700 I147M possibly damaging Het
Hipk1 A G 3: 103,778,245 F18S unknown Het
Ighv3-8 A T 12: 114,322,330 C131S probably benign Het
Il23r T G 6: 67,423,493 T618P probably damaging Het
Il31ra G A 13: 112,527,529 T538I possibly damaging Het
Kcns2 A G 15: 34,839,913 D474G unknown Het
Klc4 T C 17: 46,636,229 T407A possibly damaging Het
Klra5 C T 6: 129,911,457 S2N probably benign Het
Krt10 T C 11: 99,388,851 Y161C probably damaging Het
Kxd1 A T 8: 70,523,278 M1K probably null Het
Lgals1 A C 15: 78,928,040 D27A possibly damaging Het
Lgr5 T C 10: 115,466,346 S308G probably benign Het
Lrp1 G A 10: 127,556,988 S2736L probably benign Het
Lrpap1 G T 5: 35,102,536 H73N probably benign Het
Mcpt1 C A 14: 56,019,065 T86K probably damaging Het
Megf6 A T 4: 154,254,587 D527V probably damaging Het
Mical3 A T 6: 120,959,390 S1392T probably benign Het
Mmp2 A T 8: 92,839,382 D437V probably damaging Het
Mob4 T A 1: 55,152,722 Y166* probably null Het
Mrap2 G A 9: 87,182,474 M89I possibly damaging Het
Mug1 G A 6: 121,881,787 A1155T probably damaging Het
Myh2 G T 11: 67,193,218 A1556S probably benign Het
Nfatc3 A G 8: 106,119,322 D1028G probably benign Het
Ngef T G 1: 87,503,263 probably null Het
Nlrp1a A T 11: 71,092,513 L1209Q probably null Het
Npr2 C T 4: 43,647,553 R819C probably damaging Het
Nsd2 A T 5: 33,879,110 D646V probably damaging Het
Nsun7 A G 5: 66,277,072 H252R probably damaging Het
Olfr267 A T 4: 58,785,647 I25N possibly damaging Het
Olfr447 T A 6: 42,911,857 C111* probably null Het
Olfr642 C T 7: 104,049,740 V205I probably benign Het
Olfr951 A T 9: 39,393,860 Q20L probably benign Het
Olfr951 G T 9: 39,393,861 Q20H probably benign Het
Pcdhga2 A T 18: 37,670,585 D494V probably damaging Het
Pcsk2 A G 2: 143,813,747 E617G probably damaging Het
Pdc T C 1: 150,333,180 I138T probably damaging Het
Phc2 T A 4: 128,748,134 S750T probably damaging Het
Pkd2l1 T A 19: 44,191,508 N88Y possibly damaging Het
Plcl1 C T 1: 55,406,598 R71* probably null Het
Prag1 C A 8: 36,103,894 L544M probably damaging Het
Prkg2 A G 5: 98,966,510 probably null Het
Psd2 G A 18: 35,979,711 S153N probably damaging Het
Rab11fip1 A T 8: 27,152,972 S600T probably damaging Het
Rbms1 T G 2: 60,762,304 T222P probably benign Het
Slfn8 A T 11: 83,013,417 Y382* probably null Het
Socs4 T A 14: 47,289,738 C43* probably null Het
Sorl1 T A 9: 42,033,626 T868S probably damaging Het
St6gal1 A G 16: 23,356,213 Y267C probably damaging Het
Syne1 A G 10: 5,126,682 V6879A probably benign Het
Syne2 C A 12: 75,854,132 H22N possibly damaging Het
Tmeff2 T A 1: 50,928,021 L25Q probably damaging Het
Tmprss11g G T 5: 86,487,426 D396E probably benign Het
Tmprss11g T A 5: 86,487,436 H393L probably benign Het
Vmn2r23 A G 6: 123,704,553 E140G probably damaging Het
Wapl T C 14: 34,677,363 S130P probably benign Het
Zeb2 T A 2: 44,994,529 K982M probably damaging Het
Zfhx3 C G 8: 108,956,821 H3631D unknown Het
Zfp719 T C 7: 43,590,706 S573P probably damaging Het
Zfp979 A T 4: 147,613,542 C237S possibly damaging Het
Other mutations in Coro7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Coro7 APN 16 4634636 missense possibly damaging 0.83
IGL00885:Coro7 APN 16 4635026 missense probably benign 0.00
IGL02944:Coro7 APN 16 4635412 missense probably benign 0.14
IGL03104:Coro7 APN 16 4629126 missense probably damaging 1.00
IGL03153:Coro7 APN 16 4635382 critical splice donor site probably null
R0022:Coro7 UTSW 16 4633304 missense probably benign 0.01
R0022:Coro7 UTSW 16 4633304 missense probably benign 0.01
R0071:Coro7 UTSW 16 4670527 missense probably damaging 1.00
R0071:Coro7 UTSW 16 4670527 missense probably damaging 1.00
R0080:Coro7 UTSW 16 4630464 missense probably damaging 1.00
R0193:Coro7 UTSW 16 4627504 unclassified probably benign
R0242:Coro7 UTSW 16 4630178 splice site probably benign
R0318:Coro7 UTSW 16 4675807 missense probably benign 0.09
R0554:Coro7 UTSW 16 4632257 missense possibly damaging 0.63
R0666:Coro7 UTSW 16 4631911 missense possibly damaging 0.70
R0835:Coro7 UTSW 16 4632254 missense probably benign 0.12
R0968:Coro7 UTSW 16 4670055 splice site probably benign
R1670:Coro7 UTSW 16 4628233 missense possibly damaging 0.76
R1709:Coro7 UTSW 16 4634441 splice site probably null
R1848:Coro7 UTSW 16 4630434 missense probably damaging 0.99
R1884:Coro7 UTSW 16 4628819 unclassified probably benign
R1935:Coro7 UTSW 16 4628732 missense probably benign
R1937:Coro7 UTSW 16 4628732 missense probably benign
R1939:Coro7 UTSW 16 4628732 missense probably benign
R1967:Coro7 UTSW 16 4634889 missense probably damaging 1.00
R1969:Coro7 UTSW 16 4633756 missense probably benign 0.19
R1970:Coro7 UTSW 16 4633756 missense probably benign 0.19
R3034:Coro7 UTSW 16 4632291 missense probably damaging 0.99
R4638:Coro7 UTSW 16 4632287 missense probably damaging 0.96
R4710:Coro7 UTSW 16 4634933 intron probably benign
R4723:Coro7 UTSW 16 4631994 missense probably benign 0.00
R4789:Coro7 UTSW 16 4628221 missense probably damaging 1.00
R5493:Coro7 UTSW 16 4632487 missense probably damaging 0.99
R5619:Coro7 UTSW 16 4676935 critical splice donor site probably null
R5756:Coro7 UTSW 16 4632284 missense probably damaging 0.97
R5974:Coro7 UTSW 16 4631889 missense possibly damaging 0.83
R6010:Coro7 UTSW 16 4669956 missense possibly damaging 0.68
R6038:Coro7 UTSW 16 4679550 critical splice donor site probably null
R6038:Coro7 UTSW 16 4679550 critical splice donor site probably null
R6906:Coro7 UTSW 16 4633304 missense probably benign 0.00
R7069:Coro7 UTSW 16 4679611 start codon destroyed probably damaging 0.99
R7326:Coro7 UTSW 16 4632048 missense probably damaging 0.96
R7421:Coro7 UTSW 16 4668751 missense probably benign 0.19
R7521:Coro7 UTSW 16 4631482 missense probably benign 0.00
R7773:Coro7 UTSW 16 4632006 missense probably damaging 1.00
R7846:Coro7 UTSW 16 4670536 missense probably damaging 1.00
R8240:Coro7 UTSW 16 4668796 missense probably damaging 0.96
R8726:Coro7 UTSW 16 4668755 missense possibly damaging 0.95
R8762:Coro7 UTSW 16 4634339 missense probably benign
R9383:Coro7 UTSW 16 4635024 missense probably damaging 1.00
R9451:Coro7 UTSW 16 4670538 missense probably damaging 1.00
R9553:Coro7 UTSW 16 4668760 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- AGCCACAGAACTTGCTCTC -3'
(R):5'- GCATGTGAATGCCAGCATG -3'

Sequencing Primer
(F):5'- AGAACTTGCTCTCCAGGGGTTC -3'
(R):5'- AGGTCTCAGGCCTCTGTGTC -3'
Posted On 2018-11-28