Incidental Mutation 'R0101:Srp54b'
ID54113
Institutional Source Beutler Lab
Gene Symbol Srp54b
Ensembl Gene ENSMUSG00000112449
Gene Namesignal recognition particle 54B
Synonyms
MMRRC Submission 038387-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.223) question?
Stock #R0101 (G1)
Quality Score62
Status Validated
Chromosome12
Chromosomal Location55155104-55189573 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 55255620 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164243] [ENSMUST00000218879]
Predicted Effect probably benign
Transcript: ENSMUST00000164243
SMART Domains Protein: ENSMUSP00000132835
Gene: ENSMUSG00000079108

DomainStartEndE-ValueType
SRP54_N 2 87 7.47e-19 SMART
AAA 100 277 2.15e-7 SMART
SRP54 101 296 7.25e-90 SMART
Pfam:SRP_SPB 326 431 9.2e-33 PFAM
low complexity region 490 504 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218879
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,220,960 C1844S probably benign Het
Aatk C T 11: 120,010,913 D829N probably benign Het
B3galnt1 A G 3: 69,575,806 Y41H probably benign Het
Carmil3 A C 14: 55,497,755 probably benign Het
Cdh17 A G 4: 11,771,341 Q41R probably benign Het
Chrm2 G T 6: 36,524,495 C429F probably damaging Het
Cyld T A 8: 88,718,300 probably null Het
Cyp2d11 C A 15: 82,390,194 probably benign Het
Dnah1 A G 14: 31,283,899 Y2308H probably damaging Het
Dnajc27 T C 12: 4,089,142 V60A probably benign Het
Dnmbp A G 19: 43,874,160 V850A possibly damaging Het
Emcn A T 3: 137,341,240 M1L possibly damaging Het
Epc1 A T 18: 6,462,998 probably benign Het
Fbxo21 T C 5: 117,995,456 L310P probably damaging Het
Fgfr1op A T 17: 8,169,542 S76C possibly damaging Het
Filip1 A G 9: 79,819,528 I603T probably benign Het
Fndc3b A G 3: 27,458,808 V723A probably damaging Het
Gemin5 G A 11: 58,145,496 P674S probably damaging Het
Gsk3a T C 7: 25,228,903 D471G probably benign Het
Igbp1b G A 6: 138,657,660 P262L probably damaging Het
Itga11 T C 9: 62,744,486 L300S probably damaging Het
Itsn2 T C 12: 4,633,058 probably benign Het
Lhcgr A G 17: 88,765,170 S150P probably damaging Het
Man1a T C 10: 54,075,024 M1V probably null Het
Mical2 C T 7: 112,336,867 R892C possibly damaging Het
Mtus2 T C 5: 148,083,035 S747P probably damaging Het
Mug1 A G 6: 121,884,247 K1276E possibly damaging Het
Olfr353 A G 2: 36,890,126 S241P probably damaging Het
Pfkfb4 C G 9: 109,010,643 P260R probably benign Het
Prkca A T 11: 108,057,800 L121Q probably damaging Het
Prpf40b T C 15: 99,306,800 probably benign Het
Ripor2 T C 13: 24,680,632 M215T probably damaging Het
Rpn1 A G 6: 88,093,787 D213G possibly damaging Het
Rreb1 C A 13: 37,931,542 P959Q probably benign Het
Sema5b T C 16: 35,663,102 probably benign Het
Slc38a10 A G 11: 120,151,077 M1T probably null Het
Slco1c1 G T 6: 141,531,510 L11F probably damaging Het
Spef2 T C 15: 9,713,108 T393A probably damaging Het
St14 G T 9: 31,097,107 N512K probably benign Het
Syce1l T A 8: 113,655,429 S237T probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tamm41 A T 6: 115,032,246 Y129N probably damaging Het
Tctn2 T C 5: 124,615,294 noncoding transcript Het
Tpr T C 1: 150,409,302 probably benign Het
Vsig10 T A 5: 117,335,069 probably null Het
Zfp335 T C 2: 164,899,990 K635R probably damaging Het
Zfp541 A G 7: 16,078,043 Y207C probably damaging Het
Other mutations in Srp54b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02187:Srp54b APN 12 55252775 missense probably benign 0.39
R0395:Srp54b UTSW 12 55250099 missense probably damaging 1.00
R1076:Srp54b UTSW 12 55255528 splice site probably benign
R1186:Srp54b UTSW 12 55255528 splice site probably benign
R1520:Srp54b UTSW 12 55257569 missense possibly damaging 0.68
R1541:Srp54b UTSW 12 55256059 missense probably benign 0.27
R1732:Srp54b UTSW 12 55252759 splice site probably null
R1836:Srp54b UTSW 12 55250160 splice site probably null
R5344:Srp54b UTSW 12 55255581 missense probably damaging 1.00
R5841:Srp54b UTSW 12 55252829 missense probably benign 0.01
R6269:Srp54b UTSW 12 55255972 missense possibly damaging 0.94
R6417:Srp54b UTSW 12 55250070 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAATCTGACCATGTGCCTACTACTCC -3'
(R):5'- TCTGTGCCAAAGCCAGGAATCATC -3'

Sequencing Primer
(F):5'- TCATAGCATTCATCCCGGC -3'
(R):5'- GTCACCAGTGACTTATAGTGCTC -3'
Posted On2013-07-01