Incidental Mutation 'R6927:Tas2r115'
ID541153
Institutional Source Beutler Lab
Gene Symbol Tas2r115
Ensembl Gene ENSMUSG00000071149
Gene Nametaste receptor, type 2, member 115
SynonymsmGR15, T2R15, Tas2r15, mt2r49
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R6927 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location132737003-132738035 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 132737932 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 19 (I19F)
Ref Sequence ENSEMBL: ENSMUSP00000093043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095394]
Predicted Effect probably damaging
Transcript: ENSMUST00000095394
AA Change: I19F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093043
Gene: ENSMUSG00000071149
AA Change: I19F

DomainStartEndE-ValueType
Pfam:TAS2R 1 299 2.2e-84 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.0%
  • 20x: 96.1%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,324,391 W229R probably damaging Het
Adck2 T C 6: 39,584,064 probably null Het
Ahi1 A T 10: 21,055,069 N936I probably damaging Het
Ass1 T C 2: 31,514,801 S365P probably damaging Het
Atp9b T C 18: 80,891,857 K208E possibly damaging Het
Bag6 G A 17: 35,145,922 probably null Het
Bptf A T 11: 107,054,595 V2491E probably damaging Het
Cd300ld2 T A 11: 115,013,793 R83W probably damaging Het
Chrnd T C 1: 87,198,712 F396L probably damaging Het
Cyp3a13 G A 5: 137,895,284 P439S probably damaging Het
Dnhd1 C A 7: 105,715,563 H4279N probably damaging Het
Fam118a T C 15: 85,044,837 probably null Het
Fam198b T C 3: 79,941,462 I505T probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fasn T A 11: 120,808,289 D2386V probably benign Het
Fat1 G A 8: 45,024,495 V2170I probably benign Het
Fdps T C 3: 89,093,651 R374G probably benign Het
Fhl5 T C 4: 25,213,681 D85G probably benign Het
Flvcr1 T C 1: 191,025,664 M144V possibly damaging Het
Gpr31b A G 17: 13,051,878 S135P probably damaging Het
Hey2 A T 10: 30,834,417 D113E probably benign Het
Hoxc5 T A 15: 103,015,375 I201N probably damaging Het
Ighv1-50 A T 12: 115,120,174 W3R probably damaging Het
Impa1 A G 3: 10,315,288 I208T probably benign Het
Iqcj T C 3: 68,047,291 L43P possibly damaging Het
Itga10 T C 3: 96,656,714 F895L probably damaging Het
Kdm4b T C 17: 56,399,435 C850R probably damaging Het
Krt25 A T 11: 99,317,379 I341N probably damaging Het
L3mbtl3 T A 10: 26,292,669 R621* probably null Het
Lipm T C 19: 34,101,163 probably benign Het
Macrod2 A T 2: 142,256,521 D286V probably damaging Het
Mad2l2 T A 4: 148,140,954 V27E possibly damaging Het
Map4k4 T A 1: 40,011,682 H768Q probably benign Het
Mgat4d A G 8: 83,354,867 N83S probably benign Het
Nucb1 C T 7: 45,498,858 R141H possibly damaging Het
Olfr325 A G 11: 58,581,665 K274E possibly damaging Het
Pcdhga2 A C 18: 37,670,666 D521A probably damaging Het
Pcnx T C 12: 81,917,812 V251A probably benign Het
Pdf A T 8: 107,048,201 M133K probably damaging Het
Piezo2 A G 18: 63,032,986 F2058S probably damaging Het
Plekhb2 T A 1: 34,876,901 probably null Het
Ppp2r3a G C 9: 101,175,348 H221D probably damaging Het
Prl2c5 A T 13: 13,182,918 probably null Het
Puf60 T A 15: 76,075,814 M49L probably benign Het
Rdh16f1 T C 10: 127,788,692 V133A probably benign Het
Robo2 T A 16: 73,982,058 D389V probably damaging Het
Slc22a23 G T 13: 34,344,379 A140D probably benign Het
Slc25a42 A G 8: 70,188,923 L136P probably damaging Het
Slc36a3 T A 11: 55,129,693 M284L probably damaging Het
Tmc2 A G 2: 130,261,380 H812R probably benign Het
Vmn2r26 A G 6: 124,039,098 S174G possibly damaging Het
Vstm4 T A 14: 32,864,002 probably null Het
Vwc2 C A 11: 11,154,250 P261T probably damaging Het
Zfhx3 C G 8: 108,956,821 H3631D unknown Het
Zfp335 A G 2: 164,893,720 C1105R probably damaging Het
Zfp488 A G 14: 33,970,798 L136P probably benign Het
Zzef1 G A 11: 72,913,157 R2575H probably damaging Het
Other mutations in Tas2r115
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Tas2r115 APN 6 132737778 missense probably benign 0.11
IGL01285:Tas2r115 APN 6 132737678 missense probably damaging 1.00
IGL01516:Tas2r115 APN 6 132737613 missense probably damaging 0.98
IGL01637:Tas2r115 APN 6 132737629 missense probably damaging 0.99
IGL02041:Tas2r115 APN 6 132737467 missense probably benign 0.13
IGL02178:Tas2r115 APN 6 132737308 missense probably benign 0.11
R0467:Tas2r115 UTSW 6 132737719 missense probably benign 0.02
R0553:Tas2r115 UTSW 6 132737959 missense probably benign 0.18
R1425:Tas2r115 UTSW 6 132737479 missense probably benign 0.02
R1770:Tas2r115 UTSW 6 132737971 missense probably damaging 1.00
R2120:Tas2r115 UTSW 6 132737507 missense possibly damaging 0.51
R2136:Tas2r115 UTSW 6 132737346 missense probably damaging 0.99
R2141:Tas2r115 UTSW 6 132737358 missense probably benign 0.43
R2142:Tas2r115 UTSW 6 132737358 missense probably benign 0.43
R4479:Tas2r115 UTSW 6 132737532 missense probably damaging 0.98
R4687:Tas2r115 UTSW 6 132737284 missense possibly damaging 0.80
R4948:Tas2r115 UTSW 6 132737161 missense probably damaging 1.00
R5097:Tas2r115 UTSW 6 132737253 missense probably damaging 1.00
R5856:Tas2r115 UTSW 6 132737538 missense possibly damaging 0.86
R7473:Tas2r115 UTSW 6 132737251 missense probably damaging 1.00
R7688:Tas2r115 UTSW 6 132737680 missense probably damaging 1.00
Z1088:Tas2r115 UTSW 6 132737081 nonsense probably null
Z1176:Tas2r115 UTSW 6 132737856 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTAGTCATCAGTAATGGGGATTG -3'
(R):5'- CAGAACCTGGAAGAATTTCAGCC -3'

Sequencing Primer
(F):5'- TCATCAGTAATGGGGATTGTATAAAC -3'
(R):5'- GCTGGAGGTAAAAATCCAAAATTCTG -3'
Posted On2018-11-28