Incidental Mutation 'R6927:Nucb1'
ID541154
Institutional Source Beutler Lab
Gene Symbol Nucb1
Ensembl Gene ENSMUSG00000030824
Gene Namenucleobindin 1
SynonymsB230337F23Rik, Calnuc, MTEST82
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6927 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location45490458-45510406 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 45498858 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 141 (R141H)
Ref Sequence ENSEMBL: ENSMUSP00000147756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033096] [ENSMUST00000107758] [ENSMUST00000107759] [ENSMUST00000209436] [ENSMUST00000210813] [ENSMUST00000211343] [ENSMUST00000211682] [ENSMUST00000211765]
Predicted Effect probably benign
Transcript: ENSMUST00000033096
AA Change: R177H

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000033096
Gene: ENSMUSG00000030824
AA Change: R177H

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:EF-hand_7 227 319 2.1e-9 PFAM
coiled coil region 340 407 N/A INTRINSIC
low complexity region 420 433 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107758
SMART Domains Protein: ENSMUSP00000103387
Gene: ENSMUSG00000023467

DomainStartEndE-ValueType
low complexity region 100 108 N/A INTRINSIC
Pfam:Tub 203 451 4.1e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107759
SMART Domains Protein: ENSMUSP00000103388
Gene: ENSMUSG00000023467

DomainStartEndE-ValueType
low complexity region 100 108 N/A INTRINSIC
Pfam:Tub 203 444 3.4e-117 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209436
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000210813
Predicted Effect possibly damaging
Transcript: ENSMUST00000211343
AA Change: R141H

PolyPhen 2 Score 0.583 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000211682
AA Change: R177H

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000211765
AA Change: R177H

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.0944 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.0%
  • 20x: 96.1%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a small calcium-binding EF-hand protein family. The encoded protein is thought to have a key role in Golgi calcium homeostasis and Ca(2+)-regulated signal transduction events. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,324,391 W229R probably damaging Het
Adck2 T C 6: 39,584,064 probably null Het
Ahi1 A T 10: 21,055,069 N936I probably damaging Het
Ass1 T C 2: 31,514,801 S365P probably damaging Het
Atp9b T C 18: 80,891,857 K208E possibly damaging Het
Bag6 G A 17: 35,145,922 probably null Het
Bptf A T 11: 107,054,595 V2491E probably damaging Het
Cd300ld2 T A 11: 115,013,793 R83W probably damaging Het
Chrnd T C 1: 87,198,712 F396L probably damaging Het
Cyp3a13 G A 5: 137,895,284 P439S probably damaging Het
Dnhd1 C A 7: 105,715,563 H4279N probably damaging Het
Fam118a T C 15: 85,044,837 probably null Het
Fam198b T C 3: 79,941,462 I505T probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fasn T A 11: 120,808,289 D2386V probably benign Het
Fat1 G A 8: 45,024,495 V2170I probably benign Het
Fdps T C 3: 89,093,651 R374G probably benign Het
Fhl5 T C 4: 25,213,681 D85G probably benign Het
Flvcr1 T C 1: 191,025,664 M144V possibly damaging Het
Gpr31b A G 17: 13,051,878 S135P probably damaging Het
Hey2 A T 10: 30,834,417 D113E probably benign Het
Hoxc5 T A 15: 103,015,375 I201N probably damaging Het
Ighv1-50 A T 12: 115,120,174 W3R probably damaging Het
Impa1 A G 3: 10,315,288 I208T probably benign Het
Iqcj T C 3: 68,047,291 L43P possibly damaging Het
Itga10 T C 3: 96,656,714 F895L probably damaging Het
Kdm4b T C 17: 56,399,435 C850R probably damaging Het
Krt25 A T 11: 99,317,379 I341N probably damaging Het
L3mbtl3 T A 10: 26,292,669 R621* probably null Het
Lipm T C 19: 34,101,163 probably benign Het
Macrod2 A T 2: 142,256,521 D286V probably damaging Het
Mad2l2 T A 4: 148,140,954 V27E possibly damaging Het
Map4k4 T A 1: 40,011,682 H768Q probably benign Het
Mgat4d A G 8: 83,354,867 N83S probably benign Het
Olfr325 A G 11: 58,581,665 K274E possibly damaging Het
Pcdhga2 A C 18: 37,670,666 D521A probably damaging Het
Pcnx T C 12: 81,917,812 V251A probably benign Het
Pdf A T 8: 107,048,201 M133K probably damaging Het
Piezo2 A G 18: 63,032,986 F2058S probably damaging Het
Plekhb2 T A 1: 34,876,901 probably null Het
Ppp2r3a G C 9: 101,175,348 H221D probably damaging Het
Prl2c5 A T 13: 13,182,918 probably null Het
Puf60 T A 15: 76,075,814 M49L probably benign Het
Rdh16f1 T C 10: 127,788,692 V133A probably benign Het
Robo2 T A 16: 73,982,058 D389V probably damaging Het
Slc22a23 G T 13: 34,344,379 A140D probably benign Het
Slc25a42 A G 8: 70,188,923 L136P probably damaging Het
Slc36a3 T A 11: 55,129,693 M284L probably damaging Het
Tas2r115 T A 6: 132,737,932 I19F probably damaging Het
Tmc2 A G 2: 130,261,380 H812R probably benign Het
Vmn2r26 A G 6: 124,039,098 S174G possibly damaging Het
Vstm4 T A 14: 32,864,002 probably null Het
Vwc2 C A 11: 11,154,250 P261T probably damaging Het
Zfhx3 C G 8: 108,956,821 H3631D unknown Het
Zfp335 A G 2: 164,893,720 C1105R probably damaging Het
Zfp488 A G 14: 33,970,798 L136P probably benign Het
Zzef1 G A 11: 72,913,157 R2575H probably damaging Het
Other mutations in Nucb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Nucb1 APN 7 45501651 missense probably damaging 1.00
IGL02496:Nucb1 APN 7 45495043 splice site probably benign
R1509:Nucb1 UTSW 7 45495225 missense probably benign 0.06
R1663:Nucb1 UTSW 7 45498864 missense probably damaging 1.00
R3499:Nucb1 UTSW 7 45498876 missense probably benign 0.01
R4291:Nucb1 UTSW 7 45495280 missense probably damaging 1.00
R4983:Nucb1 UTSW 7 45498889 missense probably damaging 1.00
R5307:Nucb1 UTSW 7 45498418 missense probably damaging 0.98
R5739:Nucb1 UTSW 7 45501660 missense probably damaging 1.00
R6822:Nucb1 UTSW 7 45498865 missense probably damaging 1.00
R6874:Nucb1 UTSW 7 45503194 missense probably benign 0.13
R7424:Nucb1 UTSW 7 45498778 missense possibly damaging 0.68
R7514:Nucb1 UTSW 7 45501718 splice site probably null
Predicted Primers PCR Primer
(F):5'- TTGCCTTAAGGACTCTTGGG -3'
(R):5'- AAGCCGCTACTTTGGGAAAG -3'

Sequencing Primer
(F):5'- GCACTCATTTTCTGCTTAGGAG -3'
(R):5'- GGGAAAGCACCCCAGGG -3'
Posted On2018-11-28