Incidental Mutation 'R6927:Fan1'
ID541155
Institutional Source Beutler Lab
Gene Symbol Fan1
Ensembl Gene ENSMUSG00000033458
Gene NameFANCD2/FANCI-associated nuclease 1
SynonymsMtmr15
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6927 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location64346758-64374095 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 64372486 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 340 (N340Y)
Ref Sequence ENSEMBL: ENSMUSP00000130012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032735] [ENSMUST00000163289]
Predicted Effect probably benign
Transcript: ENSMUST00000032735
SMART Domains Protein: ENSMUSP00000032735
Gene: ENSMUSG00000030521

DomainStartEndE-ValueType
Pfam:Mpp10 20 654 6.9e-217 PFAM
low complexity region 666 671 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163289
AA Change: N340Y

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130012
Gene: ENSMUSG00000033458
AA Change: N340Y

DomainStartEndE-ValueType
SCOP:d1ihga1 600 737 5e-5 SMART
Blast:VRR_NUC 834 867 2e-12 BLAST
VRR_NUC 896 1011 1.99e-37 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206047
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206329
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206730
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206778
Meta Mutation Damage Score 0.1011 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.0%
  • 20x: 96.1%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene plays a role in DNA interstrand cross-link repair and encodes a protein with 5' flap endonuclease and 5'-3' exonuclease activity. Mutations in this gene cause karyomegalic interstitial nephritis. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for mutations in this gene display renal tubular karyomegaly with polyploidy and defects in interstrand cross-link DNA repair. Some homozygous mice also display hepatocyte karyomegaly and liver dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,324,391 W229R probably damaging Het
Adck2 T C 6: 39,584,064 probably null Het
Ahi1 A T 10: 21,055,069 N936I probably damaging Het
Ass1 T C 2: 31,514,801 S365P probably damaging Het
Atp9b T C 18: 80,891,857 K208E possibly damaging Het
Bag6 G A 17: 35,145,922 probably null Het
Bptf A T 11: 107,054,595 V2491E probably damaging Het
Cd300ld2 T A 11: 115,013,793 R83W probably damaging Het
Chrnd T C 1: 87,198,712 F396L probably damaging Het
Cyp3a13 G A 5: 137,895,284 P439S probably damaging Het
Dnhd1 C A 7: 105,715,563 H4279N probably damaging Het
Fam118a T C 15: 85,044,837 probably null Het
Fam198b T C 3: 79,941,462 I505T probably damaging Het
Fasn T A 11: 120,808,289 D2386V probably benign Het
Fat1 G A 8: 45,024,495 V2170I probably benign Het
Fdps T C 3: 89,093,651 R374G probably benign Het
Fhl5 T C 4: 25,213,681 D85G probably benign Het
Flvcr1 T C 1: 191,025,664 M144V possibly damaging Het
Gpr31b A G 17: 13,051,878 S135P probably damaging Het
Hey2 A T 10: 30,834,417 D113E probably benign Het
Hoxc5 T A 15: 103,015,375 I201N probably damaging Het
Ighv1-50 A T 12: 115,120,174 W3R probably damaging Het
Impa1 A G 3: 10,315,288 I208T probably benign Het
Iqcj T C 3: 68,047,291 L43P possibly damaging Het
Itga10 T C 3: 96,656,714 F895L probably damaging Het
Kdm4b T C 17: 56,399,435 C850R probably damaging Het
Krt25 A T 11: 99,317,379 I341N probably damaging Het
L3mbtl3 T A 10: 26,292,669 R621* probably null Het
Lipm T C 19: 34,101,163 probably benign Het
Macrod2 A T 2: 142,256,521 D286V probably damaging Het
Mad2l2 T A 4: 148,140,954 V27E possibly damaging Het
Map4k4 T A 1: 40,011,682 H768Q probably benign Het
Mgat4d A G 8: 83,354,867 N83S probably benign Het
Nucb1 C T 7: 45,498,858 R141H possibly damaging Het
Olfr325 A G 11: 58,581,665 K274E possibly damaging Het
Pcdhga2 A C 18: 37,670,666 D521A probably damaging Het
Pcnx T C 12: 81,917,812 V251A probably benign Het
Pdf A T 8: 107,048,201 M133K probably damaging Het
Piezo2 A G 18: 63,032,986 F2058S probably damaging Het
Plekhb2 T A 1: 34,876,901 probably null Het
Ppp2r3a G C 9: 101,175,348 H221D probably damaging Het
Prl2c5 A T 13: 13,182,918 probably null Het
Puf60 T A 15: 76,075,814 M49L probably benign Het
Rdh16f1 T C 10: 127,788,692 V133A probably benign Het
Robo2 T A 16: 73,982,058 D389V probably damaging Het
Slc22a23 G T 13: 34,344,379 A140D probably benign Het
Slc25a42 A G 8: 70,188,923 L136P probably damaging Het
Slc36a3 T A 11: 55,129,693 M284L probably damaging Het
Tas2r115 T A 6: 132,737,932 I19F probably damaging Het
Tmc2 A G 2: 130,261,380 H812R probably benign Het
Vmn2r26 A G 6: 124,039,098 S174G possibly damaging Het
Vstm4 T A 14: 32,864,002 probably null Het
Vwc2 C A 11: 11,154,250 P261T probably damaging Het
Zfhx3 C G 8: 108,956,821 H3631D unknown Het
Zfp335 A G 2: 164,893,720 C1105R probably damaging Het
Zfp488 A G 14: 33,970,798 L136P probably benign Het
Zzef1 G A 11: 72,913,157 R2575H probably damaging Het
Other mutations in Fan1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01648:Fan1 APN 7 64372549 missense probably damaging 0.96
IGL01752:Fan1 APN 7 64372794 missense probably benign 0.00
IGL01971:Fan1 APN 7 64353711 missense probably damaging 0.98
IGL02043:Fan1 APN 7 64371619 unclassified probably null
IGL02542:Fan1 APN 7 64364660 missense probably damaging 1.00
IGL02731:Fan1 APN 7 64372993 missense possibly damaging 0.86
IGL03111:Fan1 APN 7 64350068 missense possibly damaging 0.67
hitched UTSW 7 64364629 missense probably damaging 1.00
stitched UTSW 7 64372486 missense probably damaging 0.97
R0270:Fan1 UTSW 7 64348871 missense probably benign 0.26
R0632:Fan1 UTSW 7 64363199 missense possibly damaging 0.50
R1714:Fan1 UTSW 7 64366687 missense probably benign 0.29
R1750:Fan1 UTSW 7 64373013 missense probably benign 0.14
R1822:Fan1 UTSW 7 64372806 missense probably benign 0.00
R2031:Fan1 UTSW 7 64354424 missense probably damaging 0.98
R2107:Fan1 UTSW 7 64366788 missense probably damaging 1.00
R2126:Fan1 UTSW 7 64346888 missense probably damaging 1.00
R2869:Fan1 UTSW 7 64363190 missense probably benign 0.16
R2869:Fan1 UTSW 7 64363190 missense probably benign 0.16
R2870:Fan1 UTSW 7 64363190 missense probably benign 0.16
R2870:Fan1 UTSW 7 64363190 missense probably benign 0.16
R2871:Fan1 UTSW 7 64363190 missense probably benign 0.16
R2871:Fan1 UTSW 7 64363190 missense probably benign 0.16
R2873:Fan1 UTSW 7 64363190 missense probably benign 0.16
R3849:Fan1 UTSW 7 64372371 missense probably damaging 1.00
R3850:Fan1 UTSW 7 64372371 missense probably damaging 1.00
R3949:Fan1 UTSW 7 64371544 nonsense probably null
R4007:Fan1 UTSW 7 64366561 missense probably damaging 1.00
R4490:Fan1 UTSW 7 64369180 missense possibly damaging 0.84
R4623:Fan1 UTSW 7 64373553 nonsense probably null
R4918:Fan1 UTSW 7 64373538 utr 5 prime probably benign
R5328:Fan1 UTSW 7 64354469 missense probably damaging 1.00
R5691:Fan1 UTSW 7 64354370 unclassified probably null
R5902:Fan1 UTSW 7 64373322 unclassified probably null
R5905:Fan1 UTSW 7 64353651 missense probably benign 0.00
R6126:Fan1 UTSW 7 64364570 nonsense probably null
R6195:Fan1 UTSW 7 64354371 missense probably damaging 1.00
R6233:Fan1 UTSW 7 64354371 missense probably damaging 1.00
R6405:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6434:Fan1 UTSW 7 64354381 missense probably damaging 0.99
R6460:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6469:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6471:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6473:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6696:Fan1 UTSW 7 64350078 missense probably damaging 1.00
R6708:Fan1 UTSW 7 64372806 missense probably benign 0.00
R6713:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6714:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6749:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6841:Fan1 UTSW 7 64364629 missense probably damaging 1.00
R6858:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6859:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6860:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6925:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6936:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6938:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R6939:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7040:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7120:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7290:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7292:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7459:Fan1 UTSW 7 64348966 missense probably damaging 0.99
R7460:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7464:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7465:Fan1 UTSW 7 64353638 missense probably benign 0.30
R7465:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7608:Fan1 UTSW 7 64354231 intron probably null
R7624:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7629:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7682:Fan1 UTSW 7 64372764 missense probably benign 0.06
R7731:Fan1 UTSW 7 64372696 missense probably benign 0.17
R7863:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R7946:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R8054:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R8055:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R8057:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R8058:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R8101:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R8241:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R8262:Fan1 UTSW 7 64373306 missense probably benign 0.02
R8274:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R8275:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R8276:Fan1 UTSW 7 64372486 missense probably damaging 0.97
R8285:Fan1 UTSW 7 64366600 missense probably damaging 0.96
R8318:Fan1 UTSW 7 64350055 missense probably damaging 1.00
X0025:Fan1 UTSW 7 64372835 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCTTCTCCTGCTCATCGAAGAG -3'
(R):5'- AACACGAAATCCTCTCCGGG -3'

Sequencing Primer
(F):5'- TCATCGAAGAGCTTCATGTCC -3'
(R):5'- TCTCCGGGAGACACTCTTGTAAAG -3'
Posted On2018-11-28