Incidental Mutation 'R6927:Hey2'
ID541165
Institutional Source Beutler Lab
Gene Symbol Hey2
Ensembl Gene ENSMUSG00000019789
Gene Namehairy/enhancer-of-split related with YRPW motif 2
SynonymsbHLHb32, Hesr2, CHF1, Herp1, Hrt2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.878) question?
Stock #R6927 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location30832359-30842801 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 30834417 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 113 (D113E)
Ref Sequence ENSEMBL: ENSMUSP00000019924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019924]
Predicted Effect probably benign
Transcript: ENSMUST00000019924
AA Change: D113E

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000019924
Gene: ENSMUSG00000019789
AA Change: D113E

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
HLH 54 109 6.71e-16 SMART
ORANGE 119 166 5.55e-18 SMART
low complexity region 174 193 N/A INTRINSIC
low complexity region 253 277 N/A INTRINSIC
low complexity region 293 317 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.0%
  • 20x: 96.1%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hairy and enhancer of split-related (HESR) family of basic helix-loop-helix (bHLH)-type transcription factors. The encoded protein forms homo- or hetero-dimers that localize to the nucleus and interact with a histone deacetylase complex to repress transcription. Expression of this gene is induced by the Notch signal transduction pathway. Two similar and redundant genes in mouse are required for embryonic cardiovascular development, and are also implicated in neurogenesis and somitogenesis. Alternatively spliced transcript variants have been found, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit cardiac hypertrophy, ventricular septal defects, pulmonary and liver congestion, and reduced preweaning viability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,324,391 W229R probably damaging Het
Adck2 T C 6: 39,584,064 probably null Het
Ahi1 A T 10: 21,055,069 N936I probably damaging Het
Ass1 T C 2: 31,514,801 S365P probably damaging Het
Atp9b T C 18: 80,891,857 K208E possibly damaging Het
Bag6 G A 17: 35,145,922 probably null Het
Bptf A T 11: 107,054,595 V2491E probably damaging Het
Cd300ld2 T A 11: 115,013,793 R83W probably damaging Het
Chrnd T C 1: 87,198,712 F396L probably damaging Het
Cyp3a13 G A 5: 137,895,284 P439S probably damaging Het
Dnhd1 C A 7: 105,715,563 H4279N probably damaging Het
Fam118a T C 15: 85,044,837 probably null Het
Fam198b T C 3: 79,941,462 I505T probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fasn T A 11: 120,808,289 D2386V probably benign Het
Fat1 G A 8: 45,024,495 V2170I probably benign Het
Fdps T C 3: 89,093,651 R374G probably benign Het
Fhl5 T C 4: 25,213,681 D85G probably benign Het
Flvcr1 T C 1: 191,025,664 M144V possibly damaging Het
Gpr31b A G 17: 13,051,878 S135P probably damaging Het
Hoxc5 T A 15: 103,015,375 I201N probably damaging Het
Ighv1-50 A T 12: 115,120,174 W3R probably damaging Het
Impa1 A G 3: 10,315,288 I208T probably benign Het
Iqcj T C 3: 68,047,291 L43P possibly damaging Het
Itga10 T C 3: 96,656,714 F895L probably damaging Het
Kdm4b T C 17: 56,399,435 C850R probably damaging Het
Krt25 A T 11: 99,317,379 I341N probably damaging Het
L3mbtl3 T A 10: 26,292,669 R621* probably null Het
Lipm T C 19: 34,101,163 probably benign Het
Macrod2 A T 2: 142,256,521 D286V probably damaging Het
Mad2l2 T A 4: 148,140,954 V27E possibly damaging Het
Map4k4 T A 1: 40,011,682 H768Q probably benign Het
Mgat4d A G 8: 83,354,867 N83S probably benign Het
Nucb1 C T 7: 45,498,858 R141H possibly damaging Het
Olfr325 A G 11: 58,581,665 K274E possibly damaging Het
Pcdhga2 A C 18: 37,670,666 D521A probably damaging Het
Pcnx T C 12: 81,917,812 V251A probably benign Het
Pdf A T 8: 107,048,201 M133K probably damaging Het
Piezo2 A G 18: 63,032,986 F2058S probably damaging Het
Plekhb2 T A 1: 34,876,901 probably null Het
Ppp2r3a G C 9: 101,175,348 H221D probably damaging Het
Prl2c5 A T 13: 13,182,918 probably null Het
Puf60 T A 15: 76,075,814 M49L probably benign Het
Rdh16f1 T C 10: 127,788,692 V133A probably benign Het
Robo2 T A 16: 73,982,058 D389V probably damaging Het
Slc22a23 G T 13: 34,344,379 A140D probably benign Het
Slc25a42 A G 8: 70,188,923 L136P probably damaging Het
Slc36a3 T A 11: 55,129,693 M284L probably damaging Het
Tas2r115 T A 6: 132,737,932 I19F probably damaging Het
Tmc2 A G 2: 130,261,380 H812R probably benign Het
Vmn2r26 A G 6: 124,039,098 S174G possibly damaging Het
Vstm4 T A 14: 32,864,002 probably null Het
Vwc2 C A 11: 11,154,250 P261T probably damaging Het
Zfhx3 C G 8: 108,956,821 H3631D unknown Het
Zfp335 A G 2: 164,893,720 C1105R probably damaging Het
Zfp488 A G 14: 33,970,798 L136P probably benign Het
Zzef1 G A 11: 72,913,157 R2575H probably damaging Het
Other mutations in Hey2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01681:Hey2 APN 10 30834137 missense probably benign 0.25
IGL02525:Hey2 APN 10 30842647 start codon destroyed probably null 0.99
R0167:Hey2 UTSW 10 30840665 missense probably benign 0.04
R0279:Hey2 UTSW 10 30834010 missense probably damaging 0.97
R0553:Hey2 UTSW 10 30840489 splice site probably benign
R0592:Hey2 UTSW 10 30833957 missense probably benign 0.44
R0621:Hey2 UTSW 10 30834386 missense probably benign 0.36
R1437:Hey2 UTSW 10 30833849 missense probably benign 0.00
R1457:Hey2 UTSW 10 30834356 missense probably benign 0.45
R2449:Hey2 UTSW 10 30840446 missense possibly damaging 0.94
R4721:Hey2 UTSW 10 30834308 missense possibly damaging 0.65
R4755:Hey2 UTSW 10 30834304 missense probably benign 0.00
R4828:Hey2 UTSW 10 30834183 missense possibly damaging 0.95
R5419:Hey2 UTSW 10 30834023 missense probably benign
R7079:Hey2 UTSW 10 30834386 missense probably benign 0.36
R8196:Hey2 UTSW 10 30834277 missense probably benign
R8238:Hey2 UTSW 10 30840663 missense probably benign
Predicted Primers PCR Primer
(F):5'- CATGGAGGATGTCATCACTGC -3'
(R):5'- CTGCTAAAGTTGTTGTGCATGC -3'

Sequencing Primer
(F):5'- AGGATGTCATCACTGCTGCCTC -3'
(R):5'- GTGCATGCCACTTGTAGAGTATCC -3'
Posted On2018-11-28