Incidental Mutation 'R6927:Olfr325'
ID541169
Institutional Source Beutler Lab
Gene Symbol Olfr325
Ensembl Gene ENSMUSG00000060765
Gene Nameolfactory receptor 325
SynonymsMOR275-5, MOR275-11_p, GA_x6K02T2NKPP-844642-843680
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R6927 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location58577730-58582365 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58581665 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 274 (K274E)
Ref Sequence ENSEMBL: ENSMUSP00000145386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169428] [ENSMUST00000203418]
Predicted Effect possibly damaging
Transcript: ENSMUST00000169428
AA Change: K274E

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000131257
Gene: ENSMUSG00000060765
AA Change: K274E

DomainStartEndE-ValueType
Pfam:7tm_4 35 312 2.3e-46 PFAM
Pfam:7TM_GPCR_Srsx 39 290 1.4e-6 PFAM
Pfam:7tm_1 45 294 1.6e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000203418
AA Change: K274E

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000145386
Gene: ENSMUSG00000060765
AA Change: K274E

DomainStartEndE-ValueType
Pfam:7tm_4 35 130 7.6e-14 PFAM
Pfam:7TM_GPCR_Srsx 36 130 1.1e-4 PFAM
Pfam:7tm_1 45 130 2.6e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.0%
  • 20x: 96.1%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,324,391 W229R probably damaging Het
Adck2 T C 6: 39,584,064 probably null Het
Ahi1 A T 10: 21,055,069 N936I probably damaging Het
Ass1 T C 2: 31,514,801 S365P probably damaging Het
Atp9b T C 18: 80,891,857 K208E possibly damaging Het
Bag6 G A 17: 35,145,922 probably null Het
Bptf A T 11: 107,054,595 V2491E probably damaging Het
Cd300ld2 T A 11: 115,013,793 R83W probably damaging Het
Chrnd T C 1: 87,198,712 F396L probably damaging Het
Cyp3a13 G A 5: 137,895,284 P439S probably damaging Het
Dnhd1 C A 7: 105,715,563 H4279N probably damaging Het
Fam118a T C 15: 85,044,837 probably null Het
Fam198b T C 3: 79,941,462 I505T probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fasn T A 11: 120,808,289 D2386V probably benign Het
Fat1 G A 8: 45,024,495 V2170I probably benign Het
Fdps T C 3: 89,093,651 R374G probably benign Het
Fhl5 T C 4: 25,213,681 D85G probably benign Het
Flvcr1 T C 1: 191,025,664 M144V possibly damaging Het
Gpr31b A G 17: 13,051,878 S135P probably damaging Het
Hey2 A T 10: 30,834,417 D113E probably benign Het
Hoxc5 T A 15: 103,015,375 I201N probably damaging Het
Ighv1-50 A T 12: 115,120,174 W3R probably damaging Het
Impa1 A G 3: 10,315,288 I208T probably benign Het
Iqcj T C 3: 68,047,291 L43P possibly damaging Het
Itga10 T C 3: 96,656,714 F895L probably damaging Het
Kdm4b T C 17: 56,399,435 C850R probably damaging Het
Krt25 A T 11: 99,317,379 I341N probably damaging Het
L3mbtl3 T A 10: 26,292,669 R621* probably null Het
Lipm T C 19: 34,101,163 probably benign Het
Macrod2 A T 2: 142,256,521 D286V probably damaging Het
Mad2l2 T A 4: 148,140,954 V27E possibly damaging Het
Map4k4 T A 1: 40,011,682 H768Q probably benign Het
Mgat4d A G 8: 83,354,867 N83S probably benign Het
Nucb1 C T 7: 45,498,858 R141H possibly damaging Het
Pcdhga2 A C 18: 37,670,666 D521A probably damaging Het
Pcnx T C 12: 81,917,812 V251A probably benign Het
Pdf A T 8: 107,048,201 M133K probably damaging Het
Piezo2 A G 18: 63,032,986 F2058S probably damaging Het
Plekhb2 T A 1: 34,876,901 probably null Het
Ppp2r3a G C 9: 101,175,348 H221D probably damaging Het
Prl2c5 A T 13: 13,182,918 probably null Het
Puf60 T A 15: 76,075,814 M49L probably benign Het
Rdh16f1 T C 10: 127,788,692 V133A probably benign Het
Robo2 T A 16: 73,982,058 D389V probably damaging Het
Slc22a23 G T 13: 34,344,379 A140D probably benign Het
Slc25a42 A G 8: 70,188,923 L136P probably damaging Het
Slc36a3 T A 11: 55,129,693 M284L probably damaging Het
Tas2r115 T A 6: 132,737,932 I19F probably damaging Het
Tmc2 A G 2: 130,261,380 H812R probably benign Het
Vmn2r26 A G 6: 124,039,098 S174G possibly damaging Het
Vstm4 T A 14: 32,864,002 probably null Het
Vwc2 C A 11: 11,154,250 P261T probably damaging Het
Zfhx3 C G 8: 108,956,821 H3631D unknown Het
Zfp335 A G 2: 164,893,720 C1105R probably damaging Het
Zfp488 A G 14: 33,970,798 L136P probably benign Het
Zzef1 G A 11: 72,913,157 R2575H probably damaging Het
Other mutations in Olfr325
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Olfr325 APN 11 58581810 missense probably benign
IGL01922:Olfr325 APN 11 58581073 missense probably benign 0.01
IGL02440:Olfr325 APN 11 58581209 missense probably damaging 1.00
IGL02456:Olfr325 APN 11 58581198 missense possibly damaging 0.48
IGL03088:Olfr325 APN 11 58581827 utr 3 prime probably benign
IGL03328:Olfr325 APN 11 58581713 missense probably damaging 1.00
R0604:Olfr325 UTSW 11 58581348 missense probably damaging 0.99
R1698:Olfr325 UTSW 11 58581251 missense probably damaging 1.00
R2473:Olfr325 UTSW 11 58581575 missense probably damaging 1.00
R2888:Olfr325 UTSW 11 58581162 missense possibly damaging 0.96
R4133:Olfr325 UTSW 11 58581075 missense probably damaging 0.97
R4710:Olfr325 UTSW 11 58581722 missense probably damaging 1.00
R4715:Olfr325 UTSW 11 58581429 missense probably damaging 1.00
R4898:Olfr325 UTSW 11 58581720 missense probably damaging 1.00
R4939:Olfr325 UTSW 11 58581211 missense probably damaging 1.00
R4977:Olfr325 UTSW 11 58581629 missense possibly damaging 0.57
R5389:Olfr325 UTSW 11 58580999 missense possibly damaging 0.78
R5393:Olfr325 UTSW 11 58580999 missense possibly damaging 0.78
R6137:Olfr325 UTSW 11 58581068 missense probably benign
R6302:Olfr325 UTSW 11 58581638 missense probably benign
R6655:Olfr325 UTSW 11 58581210 missense probably damaging 1.00
R7451:Olfr325 UTSW 11 58581690 missense probably damaging 1.00
R7494:Olfr325 UTSW 11 58581212 missense probably damaging 0.97
R7626:Olfr325 UTSW 11 58581173 missense probably damaging 0.97
R7724:Olfr325 UTSW 11 58581382 missense probably benign 0.01
R7874:Olfr325 UTSW 11 58581747 missense possibly damaging 0.93
R7957:Olfr325 UTSW 11 58581747 missense possibly damaging 0.93
R8217:Olfr325 UTSW 11 58580966 missense probably benign 0.00
R8252:Olfr325 UTSW 11 58581132 missense probably damaging 1.00
Z1177:Olfr325 UTSW 11 58581311 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGACAGTCATTTCAGGCTCC -3'
(R):5'- CTGCAGGTACCATCAGCATG -3'

Sequencing Primer
(F):5'- GTGACAGTCATTTCAGGCTCCTATAC -3'
(R):5'- GGTACCATCAGCATGACACCTG -3'
Posted On2018-11-28