Incidental Mutation 'R6927:Cd300ld2'
ID541173
Institutional Source Beutler Lab
Gene Symbol Cd300ld2
Ensembl Gene ENSMUSG00000089753
Gene NameCD300 molecule like family member D2
SynonymsGm11709
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6927 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location115010335-115016193 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 115013793 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 83 (R83W)
Ref Sequence ENSEMBL: ENSMUSP00000102188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092463] [ENSMUST00000106578]
Predicted Effect probably damaging
Transcript: ENSMUST00000092463
AA Change: R83W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090120
Gene: ENSMUSG00000089753
AA Change: R83W

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 25 124 2.11e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106578
AA Change: R83W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102188
Gene: ENSMUSG00000089753
AA Change: R83W

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 25 124 2.11e-2 SMART
low complexity region 131 201 N/A INTRINSIC
low complexity region 202 222 N/A INTRINSIC
transmembrane domain 240 262 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.0%
  • 20x: 96.1%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,324,391 W229R probably damaging Het
Adck2 T C 6: 39,584,064 probably null Het
Ahi1 A T 10: 21,055,069 N936I probably damaging Het
Ass1 T C 2: 31,514,801 S365P probably damaging Het
Atp9b T C 18: 80,891,857 K208E possibly damaging Het
Bag6 G A 17: 35,145,922 probably null Het
Bptf A T 11: 107,054,595 V2491E probably damaging Het
Chrnd T C 1: 87,198,712 F396L probably damaging Het
Cyp3a13 G A 5: 137,895,284 P439S probably damaging Het
Dnhd1 C A 7: 105,715,563 H4279N probably damaging Het
Fam118a T C 15: 85,044,837 probably null Het
Fam198b T C 3: 79,941,462 I505T probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fasn T A 11: 120,808,289 D2386V probably benign Het
Fat1 G A 8: 45,024,495 V2170I probably benign Het
Fdps T C 3: 89,093,651 R374G probably benign Het
Fhl5 T C 4: 25,213,681 D85G probably benign Het
Flvcr1 T C 1: 191,025,664 M144V possibly damaging Het
Gpr31b A G 17: 13,051,878 S135P probably damaging Het
Hey2 A T 10: 30,834,417 D113E probably benign Het
Hoxc5 T A 15: 103,015,375 I201N probably damaging Het
Ighv1-50 A T 12: 115,120,174 W3R probably damaging Het
Impa1 A G 3: 10,315,288 I208T probably benign Het
Iqcj T C 3: 68,047,291 L43P possibly damaging Het
Itga10 T C 3: 96,656,714 F895L probably damaging Het
Kdm4b T C 17: 56,399,435 C850R probably damaging Het
Krt25 A T 11: 99,317,379 I341N probably damaging Het
L3mbtl3 T A 10: 26,292,669 R621* probably null Het
Lipm T C 19: 34,101,163 probably benign Het
Macrod2 A T 2: 142,256,521 D286V probably damaging Het
Mad2l2 T A 4: 148,140,954 V27E possibly damaging Het
Map4k4 T A 1: 40,011,682 H768Q probably benign Het
Mgat4d A G 8: 83,354,867 N83S probably benign Het
Nucb1 C T 7: 45,498,858 R141H possibly damaging Het
Olfr325 A G 11: 58,581,665 K274E possibly damaging Het
Pcdhga2 A C 18: 37,670,666 D521A probably damaging Het
Pcnx T C 12: 81,917,812 V251A probably benign Het
Pdf A T 8: 107,048,201 M133K probably damaging Het
Piezo2 A G 18: 63,032,986 F2058S probably damaging Het
Plekhb2 T A 1: 34,876,901 probably null Het
Ppp2r3a G C 9: 101,175,348 H221D probably damaging Het
Prl2c5 A T 13: 13,182,918 probably null Het
Puf60 T A 15: 76,075,814 M49L probably benign Het
Rdh16f1 T C 10: 127,788,692 V133A probably benign Het
Robo2 T A 16: 73,982,058 D389V probably damaging Het
Slc22a23 G T 13: 34,344,379 A140D probably benign Het
Slc25a42 A G 8: 70,188,923 L136P probably damaging Het
Slc36a3 T A 11: 55,129,693 M284L probably damaging Het
Tas2r115 T A 6: 132,737,932 I19F probably damaging Het
Tmc2 A G 2: 130,261,380 H812R probably benign Het
Vmn2r26 A G 6: 124,039,098 S174G possibly damaging Het
Vstm4 T A 14: 32,864,002 probably null Het
Vwc2 C A 11: 11,154,250 P261T probably damaging Het
Zfhx3 C G 8: 108,956,821 H3631D unknown Het
Zfp335 A G 2: 164,893,720 C1105R probably damaging Het
Zfp488 A G 14: 33,970,798 L136P probably benign Het
Zzef1 G A 11: 72,913,157 R2575H probably damaging Het
Other mutations in Cd300ld2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Cd300ld2 APN 11 115012297 missense probably benign 0.23
IGL01450:Cd300ld2 APN 11 115012543 unclassified probably benign
IGL01452:Cd300ld2 APN 11 115012602 unclassified probably benign
IGL02086:Cd300ld2 APN 11 115012558 unclassified probably benign
IGL02111:Cd300ld2 APN 11 115012393 unclassified probably benign
IGL02505:Cd300ld2 APN 11 115013687 missense probably benign 0.11
IGL02517:Cd300ld2 APN 11 115010423 missense possibly damaging 0.53
IGL02836:Cd300ld2 APN 11 115013750 missense probably benign 0.07
IGL03081:Cd300ld2 APN 11 115012542 unclassified probably benign
PIT4486001:Cd300ld2 UTSW 11 115012431 small deletion probably benign
R0579:Cd300ld2 UTSW 11 115012299 missense probably benign 0.23
R1065:Cd300ld2 UTSW 11 115013760 missense probably damaging 1.00
R1393:Cd300ld2 UTSW 11 115012578 unclassified probably benign
R1481:Cd300ld2 UTSW 11 115012633 missense probably benign 0.36
R1583:Cd300ld2 UTSW 11 115013777 missense probably benign 0.06
R1755:Cd300ld2 UTSW 11 115013775 missense probably benign 0.01
R1865:Cd300ld2 UTSW 11 115012618 unclassified probably benign
R4018:Cd300ld2 UTSW 11 115012504 unclassified probably benign
R5516:Cd300ld2 UTSW 11 115012444 unclassified probably benign
R6065:Cd300ld2 UTSW 11 115012602 unclassified probably benign
R7874:Cd300ld2 UTSW 11 115012431 small deletion probably benign
R7883:Cd300ld2 UTSW 11 115012431 small deletion probably benign
R8044:Cd300ld2 UTSW 11 115013719 nonsense probably null
R8263:Cd300ld2 UTSW 11 115012366 missense unknown
R8306:Cd300ld2 UTSW 11 115013822 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CTTGGCAGGACAAATACAGTAGAC -3'
(R):5'- ATCCAGTCACAGGTCCAGAG -3'

Sequencing Primer
(F):5'- AGGACCCTTGATACTTCACCAGG -3'
(R):5'- TCACAGGTCCAGAGGAGGTG -3'
Posted On2018-11-28