Mutagenetix > Incidental Mutation

Incidental Mutation 'R6927:Piezo2'

541188

Institutional Source

Beutler Lab

Gene Symbol

Piezo2

Ensembl Gene

ENSMUSG00000041482

Gene Name

piezo-type mechanosensitive ion channel component 2

Synonyms

Fam38b, Fam38b2, 9030411M15Rik, Piezo2, 9430028L06Rik

MMRRC Submission

045044-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6927 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

63010213-63387183 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 63032986 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 2058 (F2058S)

Ref Sequence

ENSEMBL: ENSMUSP00000040019 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047480]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000047480
AA Change: F2058S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000040019
Gene: ENSMUSG00000041482
AA Change: F2058S

Domain	Start	End	E-Value	Type
transmembrane domain	13	44	N/A	INTRINSIC
transmembrane domain	59	81	N/A	INTRINSIC
low complexity region	179	194	N/A	INTRINSIC
transmembrane domain	214	236	N/A	INTRINSIC
transmembrane domain	241	260	N/A	INTRINSIC
transmembrane domain	267	289	N/A	INTRINSIC
coiled coil region	455	482	N/A	INTRINSIC
transmembrane domain	504	526	N/A	INTRINSIC
transmembrane domain	539	561	N/A	INTRINSIC
SCOP:d1eq1a_	597	666	4e-3	SMART
transmembrane domain	682	704	N/A	INTRINSIC
transmembrane domain	708	730	N/A	INTRINSIC
internal_repeat_1	740	764	6.01e-5	PROSPERO
low complexity region	772	784	N/A	INTRINSIC
transmembrane domain	791	813	N/A	INTRINSIC
low complexity region	900	921	N/A	INTRINSIC
transmembrane domain	949	971	N/A	INTRINSIC
transmembrane domain	976	993	N/A	INTRINSIC
transmembrane domain	1000	1022	N/A	INTRINSIC
transmembrane domain	1069	1091	N/A	INTRINSIC
transmembrane domain	1130	1152	N/A	INTRINSIC
transmembrane domain	1156	1173	N/A	INTRINSIC
transmembrane domain	1186	1208	N/A	INTRINSIC
transmembrane domain	1234	1256	N/A	INTRINSIC
transmembrane domain	1308	1327	N/A	INTRINSIC
transmembrane domain	1331	1353	N/A	INTRINSIC
Pfam:PIEZO	1383	1617	1.1e-105	PFAM
low complexity region	1807	1823	N/A	INTRINSIC
low complexity region	1836	1860	N/A	INTRINSIC
low complexity region	1863	1878	N/A	INTRINSIC
transmembrane domain	1981	2003	N/A	INTRINSIC
transmembrane domain	2010	2027	N/A	INTRINSIC
internal_repeat_1	2036	2060	6.01e-5	PROSPERO
low complexity region	2167	2199	N/A	INTRINSIC
transmembrane domain	2261	2283	N/A	INTRINSIC
transmembrane domain	2303	2325	N/A	INTRINSIC
transmembrane domain	2332	2354	N/A	INTRINSIC
transmembrane domain	2364	2386	N/A	INTRINSIC
Pfam:Piezo_RRas_bdg	2412	2821	2.8e-161	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000137141

SMART Domains

Protein: ENSMUSP00000117107
Gene: ENSMUSG00000041482

Domain	Start	End	E-Value	Type
low complexity region	3	22	N/A	INTRINSIC
transmembrane domain	84	106	N/A	INTRINSIC
transmembrane domain	126	148	N/A	INTRINSIC
transmembrane domain	155	177	N/A	INTRINSIC
transmembrane domain	187	209	N/A	INTRINSIC
Pfam:Piezo_RRas_bdg	235	409	4.6e-78	PFAM

Meta Mutation Damage Score

0.2860

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.0%
20x: 96.1%

Validation Efficiency

98% (57/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains more than thirty transmembrane domains and likely functions as part of mechanically-activated (MA) cation channels. These channels serve to connect mechanical forces to biological signals. The encoded protein quickly adapts MA currents in somatosensory neurons. Defects in this gene are a cause of type 5 distal arthrogryposis. Several alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2014]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc10	A	T	17: 46,324,391 (GRCm38)	W229R	probably damaging	Het
Adck2	T	C	6: 39,584,064 (GRCm38)		probably null	Het
Ahi1	A	T	10: 21,055,069 (GRCm38)	N936I	probably damaging	Het
Ass1	T	C	2: 31,514,801 (GRCm38)	S365P	probably damaging	Het
Atp9b	T	C	18: 80,891,857 (GRCm38)	K208E	possibly damaging	Het
Bag6	G	A	17: 35,145,922 (GRCm38)		probably null	Het
Bptf	A	T	11: 107,054,595 (GRCm38)	V2491E	probably damaging	Het
Cd300ld2	T	A	11: 115,013,793 (GRCm38)	R83W	probably damaging	Het
Chrnd	T	C	1: 87,198,712 (GRCm38)	F396L	probably damaging	Het
Cyp3a13	G	A	5: 137,895,284 (GRCm38)	P439S	probably damaging	Het
Dnhd1	C	A	7: 105,715,563 (GRCm38)	H4279N	probably damaging	Het
Fam118a	T	C	15: 85,044,837 (GRCm38)		probably null	Het
Fam198b	T	C	3: 79,941,462 (GRCm38)	I505T	probably damaging	Het
Fan1	T	A	7: 64,372,486 (GRCm38)	N340Y	probably damaging	Het
Fasn	T	A	11: 120,808,289 (GRCm38)	D2386V	probably benign	Het
Fat1	G	A	8: 45,024,495 (GRCm38)	V2170I	probably benign	Het
Fdps	T	C	3: 89,093,651 (GRCm38)	R374G	probably benign	Het
Fhl5	T	C	4: 25,213,681 (GRCm38)	D85G	probably benign	Het
Flvcr1	T	C	1: 191,025,664 (GRCm38)	M144V	possibly damaging	Het
Gpr31b	A	G	17: 13,051,878 (GRCm38)	S135P	probably damaging	Het
Hey2	A	T	10: 30,834,417 (GRCm38)	D113E	probably benign	Het
Hoxc5	T	A	15: 103,015,375 (GRCm38)	I201N	probably damaging	Het
Ighv1-50	A	T	12: 115,120,174 (GRCm38)	W3R	probably damaging	Het
Impa1	A	G	3: 10,315,288 (GRCm38)	I208T	probably benign	Het
Iqcj	T	C	3: 68,047,291 (GRCm38)	L43P	possibly damaging	Het
Itga10	T	C	3: 96,656,714 (GRCm38)	F895L	probably damaging	Het
Kdm4b	T	C	17: 56,399,435 (GRCm38)	C850R	probably damaging	Het
Krt25	A	T	11: 99,317,379 (GRCm38)	I341N	probably damaging	Het
L3mbtl3	T	A	10: 26,292,669 (GRCm38)	R621*	probably null	Het
Lipm	T	C	19: 34,101,163 (GRCm38)		probably benign	Het
Macrod2	A	T	2: 142,256,521 (GRCm38)	D286V	probably damaging	Het
Mad2l2	T	A	4: 148,140,954 (GRCm38)	V27E	possibly damaging	Het
Map4k4	T	A	1: 40,011,682 (GRCm38)	H768Q	probably benign	Het
Mgat4d	A	G	8: 83,354,867 (GRCm38)	N83S	probably benign	Het
Nucb1	C	T	7: 45,498,858 (GRCm38)	R141H	possibly damaging	Het
Olfr325	A	G	11: 58,581,665 (GRCm38)	K274E	possibly damaging	Het
Pcdhga2	A	C	18: 37,670,666 (GRCm38)	D521A	probably damaging	Het
Pcnx	T	C	12: 81,917,812 (GRCm38)	V251A	probably benign	Het
Pdf	A	T	8: 107,048,201 (GRCm38)	M133K	probably damaging	Het
Plekhb2	T	A	1: 34,876,901 (GRCm38)		probably null	Het
Ppp2r3a	G	C	9: 101,175,348 (GRCm38)	H221D	probably damaging	Het
Prl2c5	A	T	13: 13,182,918 (GRCm38)		probably null	Het
Puf60	T	A	15: 76,075,814 (GRCm38)	M49L	probably benign	Het
Rdh16f1	T	C	10: 127,788,692 (GRCm38)	V133A	probably benign	Het
Robo2	T	A	16: 73,982,058 (GRCm38)	D389V	probably damaging	Het
Slc22a23	G	T	13: 34,344,379 (GRCm38)	A140D	probably benign	Het
Slc25a42	A	G	8: 70,188,923 (GRCm38)	L136P	probably damaging	Het
Slc36a3	T	A	11: 55,129,693 (GRCm38)	M284L	probably damaging	Het
Tas2r115	T	A	6: 132,737,932 (GRCm38)	I19F	probably damaging	Het
Tmc2	A	G	2: 130,261,380 (GRCm38)	H812R	probably benign	Het
Vmn2r26	A	G	6: 124,039,098 (GRCm38)	S174G	possibly damaging	Het
Vstm4	T	A	14: 32,864,002 (GRCm38)		probably null	Het
Vwc2	C	A	11: 11,154,250 (GRCm38)	P261T	probably damaging	Het
Zfhx3	C	G	8: 108,956,821 (GRCm38)	H3631D	unknown	Het
Zfp335	A	G	2: 164,893,720 (GRCm38)	C1105R	probably damaging	Het
Zfp488	A	G	14: 33,970,798 (GRCm38)	L136P	probably benign	Het
Zzef1	G	A	11: 72,913,157 (GRCm38)	R2575H	probably damaging	Het

Other mutations in Piezo2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01360:Piezo2	APN	18	63,117,699 (GRCm38)	missense	probably damaging	1.00
IGL01370:Piezo2	APN	18	63,022,460 (GRCm38)	missense	probably damaging	1.00
IGL01543:Piezo2	APN	18	63,070,030 (GRCm38)	missense	probably damaging	1.00
IGL01561:Piezo2	APN	18	63,124,614 (GRCm38)	missense	probably benign	0.03
IGL01568:Piezo2	APN	18	63,030,392 (GRCm38)	missense	probably benign	0.28
IGL01653:Piezo2	APN	18	63,182,833 (GRCm38)	splice site	probably benign
IGL01674:Piezo2	APN	18	63,027,559 (GRCm38)	missense	probably damaging	1.00
IGL01684:Piezo2	APN	18	63,083,170 (GRCm38)	missense	probably damaging	1.00
IGL01744:Piezo2	APN	18	63,042,788 (GRCm38)	missense	probably damaging	1.00
IGL01859:Piezo2	APN	18	63,092,844 (GRCm38)	missense	probably benign	0.10
IGL02183:Piezo2	APN	18	63,020,634 (GRCm38)	missense	probably benign	0.00
IGL02407:Piezo2	APN	18	63,146,844 (GRCm38)	missense	probably damaging	1.00
IGL02441:Piezo2	APN	18	63,072,862 (GRCm38)	missense	probably damaging	1.00
IGL02542:Piezo2	APN	18	63,032,924 (GRCm38)	missense	probably damaging	0.96
IGL02652:Piezo2	APN	18	63,024,475 (GRCm38)	missense	probably damaging	1.00
IGL02710:Piezo2	APN	18	63,074,659 (GRCm38)	missense	probably damaging	1.00
IGL02850:Piezo2	APN	18	63,020,633 (GRCm38)	missense	probably benign	0.18
IGL02851:Piezo2	APN	18	63,020,633 (GRCm38)	missense	probably benign	0.18
IGL02972:Piezo2	APN	18	63,064,785 (GRCm38)	splice site	probably benign
IGL03011:Piezo2	APN	18	63,124,660 (GRCm38)	missense	probably benign	0.03
IGL03078:Piezo2	APN	18	63,070,075 (GRCm38)	missense	probably damaging	1.00
IGL03114:Piezo2	APN	18	63,030,272 (GRCm38)	splice site	probably null
IGL03129:Piezo2	APN	18	63,114,972 (GRCm38)	missense	probably benign
IGL03143:Piezo2	APN	18	63,108,076 (GRCm38)	missense	probably damaging	0.99
IGL03202:Piezo2	APN	18	63,011,598 (GRCm38)	missense	probably damaging	1.00
IGL03227:Piezo2	APN	18	63,124,606 (GRCm38)	missense	probably damaging	1.00
IGL03228:Piezo2	APN	18	63,053,062 (GRCm38)	missense	probably damaging	1.00
IGL03230:Piezo2	APN	18	63,041,720 (GRCm38)	missense	probably damaging	1.00
IGL03242:Piezo2	APN	18	63,011,538 (GRCm38)	utr 3 prime	probably benign
IGL03291:Piezo2	APN	18	63,021,308 (GRCm38)	missense	probably damaging	1.00
IGL03301:Piezo2	APN	18	63,027,704 (GRCm38)	missense	probably damaging	1.00
Piccolo	UTSW	18	63,011,696 (GRCm38)	missense	probably damaging	1.00
sopranino	UTSW	18	63,024,466 (GRCm38)	missense	probably damaging	1.00
woodwind	UTSW	18	63,124,642 (GRCm38)	missense	possibly damaging	0.50
P0023:Piezo2	UTSW	18	63,386,200 (GRCm38)	splice site	probably benign
PIT4802001:Piezo2	UTSW	18	63,024,469 (GRCm38)	missense	probably damaging	1.00
R0070:Piezo2	UTSW	18	63,102,084 (GRCm38)	missense	probably damaging	1.00
R0416:Piezo2	UTSW	18	63,024,491 (GRCm38)	missense	probably damaging	1.00
R0486:Piezo2	UTSW	18	63,029,061 (GRCm38)	missense	probably damaging	1.00
R0498:Piezo2	UTSW	18	63,102,174 (GRCm38)	missense	possibly damaging	0.87
R0504:Piezo2	UTSW	18	63,024,451 (GRCm38)	missense	probably damaging	1.00
R0506:Piezo2	UTSW	18	63,027,544 (GRCm38)	missense	probably damaging	1.00
R0523:Piezo2	UTSW	18	63,022,481 (GRCm38)	missense	probably damaging	1.00
R0587:Piezo2	UTSW	18	63,022,426 (GRCm38)	missense	possibly damaging	0.82
R0626:Piezo2	UTSW	18	63,019,258 (GRCm38)	missense	probably damaging	0.97
R0734:Piezo2	UTSW	18	63,041,723 (GRCm38)	missense	probably damaging	1.00
R0784:Piezo2	UTSW	18	63,083,235 (GRCm38)	missense	probably damaging	1.00
R0973:Piezo2	UTSW	18	63,015,802 (GRCm38)	missense	probably damaging	1.00
R1183:Piezo2	UTSW	18	63,086,753 (GRCm38)	missense	probably damaging	1.00
R1344:Piezo2	UTSW	18	63,021,254 (GRCm38)	missense	probably damaging	1.00
R1474:Piezo2	UTSW	18	63,083,131 (GRCm38)	missense	probably damaging	1.00
R1571:Piezo2	UTSW	18	63,144,919 (GRCm38)	missense	possibly damaging	0.67
R1643:Piezo2	UTSW	18	63,082,915 (GRCm38)	missense	probably benign	0.03
R1649:Piezo2	UTSW	18	63,117,672 (GRCm38)	missense	probably benign	0.34
R1741:Piezo2	UTSW	18	63,021,173 (GRCm38)	missense	probably damaging	1.00
R1764:Piezo2	UTSW	18	63,124,642 (GRCm38)	missense	possibly damaging	0.50
R1793:Piezo2	UTSW	18	63,106,284 (GRCm38)	missense	possibly damaging	0.78
R1799:Piezo2	UTSW	18	63,108,087 (GRCm38)	missense	probably damaging	1.00
R1799:Piezo2	UTSW	18	63,032,840 (GRCm38)	critical splice donor site	probably null
R1868:Piezo2	UTSW	18	63,019,344 (GRCm38)	missense	probably damaging	1.00
R1879:Piezo2	UTSW	18	63,113,960 (GRCm38)	missense	probably damaging	1.00
R1962:Piezo2	UTSW	18	63,078,840 (GRCm38)	missense	probably damaging	0.98
R1990:Piezo2	UTSW	18	63,074,662 (GRCm38)	missense	probably null	1.00
R1991:Piezo2	UTSW	18	63,074,662 (GRCm38)	missense	probably null	1.00
R1992:Piezo2	UTSW	18	63,074,662 (GRCm38)	missense	probably null	1.00
R1995:Piezo2	UTSW	18	63,078,781 (GRCm38)	missense	probably damaging	1.00
R2004:Piezo2	UTSW	18	63,144,926 (GRCm38)	missense	probably damaging	1.00
R2011:Piezo2	UTSW	18	63,059,744 (GRCm38)	missense	probably damaging	1.00
R2029:Piezo2	UTSW	18	63,118,935 (GRCm38)	missense	possibly damaging	0.62
R2075:Piezo2	UTSW	18	63,081,734 (GRCm38)	missense	probably damaging	1.00
R2078:Piezo2	UTSW	18	63,117,720 (GRCm38)	missense	probably damaging	0.99
R2152:Piezo2	UTSW	18	63,114,041 (GRCm38)	missense	probably damaging	1.00
R2162:Piezo2	UTSW	18	63,081,662 (GRCm38)	critical splice donor site	probably null
R2183:Piezo2	UTSW	18	63,106,274 (GRCm38)	missense	probably damaging	1.00
R2230:Piezo2	UTSW	18	63,145,072 (GRCm38)	missense	probably damaging	1.00
R2231:Piezo2	UTSW	18	63,145,072 (GRCm38)	missense	probably damaging	1.00
R2406:Piezo2	UTSW	18	63,022,525 (GRCm38)	missense	probably damaging	1.00
R2431:Piezo2	UTSW	18	63,245,624 (GRCm38)	missense	possibly damaging	0.95
R2876:Piezo2	UTSW	18	63,053,035 (GRCm38)	missense	probably damaging	1.00
R2935:Piezo2	UTSW	18	63,146,843 (GRCm38)	missense	probably damaging	1.00
R3004:Piezo2	UTSW	18	63,024,435 (GRCm38)	nonsense	probably null
R3016:Piezo2	UTSW	18	63,042,832 (GRCm38)	missense	probably damaging	1.00
R3794:Piezo2	UTSW	18	63,081,793 (GRCm38)	missense	probably damaging	0.99
R3832:Piezo2	UTSW	18	63,081,662 (GRCm38)	critical splice donor site	probably null
R3833:Piezo2	UTSW	18	63,081,662 (GRCm38)	critical splice donor site	probably null
R3968:Piezo2	UTSW	18	63,011,696 (GRCm38)	missense	probably damaging	1.00
R3969:Piezo2	UTSW	18	63,011,696 (GRCm38)	missense	probably damaging	1.00
R3970:Piezo2	UTSW	18	63,011,696 (GRCm38)	missense	probably damaging	1.00
R4169:Piezo2	UTSW	18	63,050,604 (GRCm38)	missense	probably benign
R4181:Piezo2	UTSW	18	63,124,730 (GRCm38)	critical splice acceptor site	probably null
R4301:Piezo2	UTSW	18	63,084,840 (GRCm38)	missense	probably damaging	1.00
R4302:Piezo2	UTSW	18	63,124,730 (GRCm38)	critical splice acceptor site	probably null
R4475:Piezo2	UTSW	18	63,102,099 (GRCm38)	missense	probably damaging	1.00
R4493:Piezo2	UTSW	18	63,114,063 (GRCm38)	missense	probably damaging	0.98
R4519:Piezo2	UTSW	18	63,072,880 (GRCm38)	missense	probably damaging	1.00
R4539:Piezo2	UTSW	18	63,086,628 (GRCm38)	missense	probably damaging	1.00
R4687:Piezo2	UTSW	18	63,069,963 (GRCm38)	missense	probably damaging	1.00
R4732:Piezo2	UTSW	18	63,030,401 (GRCm38)	missense	probably damaging	1.00
R4733:Piezo2	UTSW	18	63,030,401 (GRCm38)	missense	probably damaging	1.00
R4825:Piezo2	UTSW	18	63,144,954 (GRCm38)	missense	probably damaging	0.98
R4899:Piezo2	UTSW	18	63,078,791 (GRCm38)	missense	possibly damaging	0.84
R4946:Piezo2	UTSW	18	63,157,262 (GRCm38)	missense	probably benign
R4961:Piezo2	UTSW	18	63,052,961 (GRCm38)	splice site	probably null
R4968:Piezo2	UTSW	18	63,144,971 (GRCm38)	nonsense	probably null
R4973:Piezo2	UTSW	18	63,074,680 (GRCm38)	missense	probably damaging	1.00
R4997:Piezo2	UTSW	18	63,083,113 (GRCm38)	missense	probably damaging	1.00
R5078:Piezo2	UTSW	18	63,024,536 (GRCm38)	missense	probably damaging	1.00
R5134:Piezo2	UTSW	18	63,074,620 (GRCm38)	missense	probably damaging	1.00
R5151:Piezo2	UTSW	18	63,030,409 (GRCm38)	missense	possibly damaging	0.72
R5209:Piezo2	UTSW	18	63,032,929 (GRCm38)	missense	probably damaging	1.00
R5367:Piezo2	UTSW	18	63,064,731 (GRCm38)	missense	probably damaging	1.00
R5401:Piezo2	UTSW	18	63,084,740 (GRCm38)	missense	possibly damaging	0.81
R5464:Piezo2	UTSW	18	63,145,105 (GRCm38)	missense	probably damaging	1.00
R5469:Piezo2	UTSW	18	63,027,864 (GRCm38)	missense	probably damaging	1.00
R5650:Piezo2	UTSW	18	63,011,721 (GRCm38)	missense	probably damaging	1.00
R5654:Piezo2	UTSW	18	63,145,091 (GRCm38)	missense	possibly damaging	0.94
R5677:Piezo2	UTSW	18	63,117,697 (GRCm38)	missense	probably benign	0.25
R5677:Piezo2	UTSW	18	63,117,696 (GRCm38)	missense	possibly damaging	0.94
R5792:Piezo2	UTSW	18	63,146,856 (GRCm38)	missense	probably damaging	1.00
R5874:Piezo2	UTSW	18	63,027,901 (GRCm38)	missense	probably damaging	1.00
R5877:Piezo2	UTSW	18	63,113,934 (GRCm38)	missense	probably benign	0.22
R6036:Piezo2	UTSW	18	63,114,948 (GRCm38)	nonsense	probably null
R6036:Piezo2	UTSW	18	63,114,948 (GRCm38)	nonsense	probably null
R6073:Piezo2	UTSW	18	63,012,645 (GRCm38)	missense	probably damaging	1.00
R6198:Piezo2	UTSW	18	63,157,210 (GRCm38)	nonsense	probably null
R6255:Piezo2	UTSW	18	63,121,270 (GRCm38)	missense	possibly damaging	0.75
R6259:Piezo2	UTSW	18	63,117,678 (GRCm38)	missense	possibly damaging	0.69
R6391:Piezo2	UTSW	18	63,106,293 (GRCm38)	missense	possibly damaging	0.79
R6446:Piezo2	UTSW	18	63,086,607 (GRCm38)	missense	probably damaging	1.00
R6465:Piezo2	UTSW	18	63,041,663 (GRCm38)	missense	possibly damaging	0.82
R6518:Piezo2	UTSW	18	63,106,271 (GRCm38)	missense	probably damaging	0.99
R6521:Piezo2	UTSW	18	63,021,328 (GRCm38)	missense	probably damaging	1.00
R6625:Piezo2	UTSW	18	63,021,262 (GRCm38)	missense	probably damaging	1.00
R6744:Piezo2	UTSW	18	63,032,889 (GRCm38)	nonsense	probably null
R6855:Piezo2	UTSW	18	63,090,879 (GRCm38)	critical splice donor site	probably null
R6980:Piezo2	UTSW	18	63,082,961 (GRCm38)	critical splice acceptor site	probably null
R7141:Piezo2	UTSW	18	63,145,110 (GRCm38)	nonsense	probably null
R7162:Piezo2	UTSW	18	63,124,709 (GRCm38)	missense	possibly damaging	0.50
R7331:Piezo2	UTSW	18	63,108,030 (GRCm38)	missense	probably damaging	0.99
R7382:Piezo2	UTSW	18	63,017,519 (GRCm38)	splice site	probably null
R7395:Piezo2	UTSW	18	63,027,563 (GRCm38)	missense	probably damaging	1.00
R7448:Piezo2	UTSW	18	63,024,472 (GRCm38)	missense	probably damaging	1.00
R7465:Piezo2	UTSW	18	63,012,723 (GRCm38)	missense	probably benign
R7517:Piezo2	UTSW	18	63,082,925 (GRCm38)	missense	possibly damaging	0.52
R7577:Piezo2	UTSW	18	63,053,010 (GRCm38)	missense	probably benign	0.01
R7612:Piezo2	UTSW	18	63,042,539 (GRCm38)	missense	probably benign	0.12
R7829:Piezo2	UTSW	18	63,113,876 (GRCm38)	critical splice donor site	probably null
R7835:Piezo2	UTSW	18	63,082,945 (GRCm38)	missense	probably benign	0.12
R8014:Piezo2	UTSW	18	63,083,200 (GRCm38)	missense	probably benign	0.02
R8055:Piezo2	UTSW	18	63,042,811 (GRCm38)	missense	probably damaging	0.99
R8062:Piezo2	UTSW	18	63,030,466 (GRCm38)	missense	possibly damaging	0.87
R8306:Piezo2	UTSW	18	63,075,730 (GRCm38)	missense	probably damaging	1.00
R8332:Piezo2	UTSW	18	63,012,786 (GRCm38)	missense	possibly damaging	0.67
R8355:Piezo2	UTSW	18	63,090,998 (GRCm38)	missense	probably damaging	1.00
R8383:Piezo2	UTSW	18	63,084,688 (GRCm38)	missense	probably damaging	0.97
R8455:Piezo2	UTSW	18	63,090,998 (GRCm38)	missense	probably damaging	1.00
R8501:Piezo2	UTSW	18	63,045,540 (GRCm38)	missense	probably damaging	0.99
R8523:Piezo2	UTSW	18	63,146,802 (GRCm38)	missense	probably damaging	0.99
R8692:Piezo2	UTSW	18	63,092,900 (GRCm38)	nonsense	probably null
R8708:Piezo2	UTSW	18	63,093,015 (GRCm38)	missense	probably damaging	1.00
R8726:Piezo2	UTSW	18	63,109,885 (GRCm38)	missense	probably benign
R8727:Piezo2	UTSW	18	63,109,885 (GRCm38)	missense	probably benign
R8810:Piezo2	UTSW	18	63,114,963 (GRCm38)	missense	probably benign	0.41
R8900:Piezo2	UTSW	18	63,115,025 (GRCm38)	missense	probably benign	0.04
R9037:Piezo2	UTSW	18	63,092,831 (GRCm38)	missense	probably benign	0.31
R9079:Piezo2	UTSW	18	63,024,466 (GRCm38)	missense	probably damaging	1.00
R9090:Piezo2	UTSW	18	63,075,719 (GRCm38)	missense	probably damaging	0.99
R9090:Piezo2	UTSW	18	63,030,379 (GRCm38)	missense	probably damaging	0.99
R9123:Piezo2	UTSW	18	63,045,518 (GRCm38)	missense	probably benign	0.00
R9125:Piezo2	UTSW	18	63,045,518 (GRCm38)	missense	probably benign	0.00
R9171:Piezo2	UTSW	18	63,045,479 (GRCm38)	missense	probably benign	0.04
R9194:Piezo2	UTSW	18	63,117,744 (GRCm38)	missense	probably benign	0.03
R9203:Piezo2	UTSW	18	63,157,231 (GRCm38)	missense	probably benign	0.00
R9209:Piezo2	UTSW	18	63,021,301 (GRCm38)	missense	probably damaging	1.00
R9261:Piezo2	UTSW	18	63,075,797 (GRCm38)	missense	possibly damaging	0.84
R9271:Piezo2	UTSW	18	63,030,379 (GRCm38)	missense	probably damaging	0.99
R9271:Piezo2	UTSW	18	63,075,719 (GRCm38)	missense	probably damaging	0.99
R9283:Piezo2	UTSW	18	63,024,566 (GRCm38)	missense	probably damaging	1.00
R9377:Piezo2	UTSW	18	63,029,085 (GRCm38)	missense	possibly damaging	0.48
R9499:Piezo2	UTSW	18	63,032,962 (GRCm38)	missense	possibly damaging	0.67
R9531:Piezo2	UTSW	18	63,102,165 (GRCm38)	missense	possibly damaging	0.95
R9551:Piezo2	UTSW	18	63,032,962 (GRCm38)	missense	possibly damaging	0.67
R9607:Piezo2	UTSW	18	63,386,276 (GRCm38)	start gained	probably benign
R9608:Piezo2	UTSW	18	63,146,945 (GRCm38)	missense	probably benign	0.09
R9617:Piezo2	UTSW	18	63,115,037 (GRCm38)	missense	probably benign	0.43
R9624:Piezo2	UTSW	18	63,064,696 (GRCm38)	missense	possibly damaging	0.88
X0017:Piezo2	UTSW	18	63,027,586 (GRCm38)	missense	probably damaging	0.99
X0022:Piezo2	UTSW	18	63,050,610 (GRCm38)	missense	probably benign	0.43
X0060:Piezo2	UTSW	18	63,017,577 (GRCm38)	missense	probably benign	0.09
Z1088:Piezo2	UTSW	18	63,069,994 (GRCm38)	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GACTGAACTTCTAACACGGGG -3'
(R):5'- TTCAAACCCAGGAGCTCTGAG -3'

Sequencing Primer
(F):5'- CTTCTAACACGGGGGCAATG -3'
(R):5'- CCAGGAGCTCTGAGATCATTAC -3'

Posted On

2018-11-28