Incidental Mutation 'R6950:Slc9a4'
ID541191
Institutional Source Beutler Lab
Gene Symbol Slc9a4
Ensembl Gene ENSMUSG00000026065
Gene Namesolute carrier family 9 (sodium/hydrogen exchanger), member 4
SynonymsD730009J23Rik, NHE4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6950 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location40580081-40630725 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40602885 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 338 (Y338C)
Ref Sequence ENSEMBL: ENSMUSP00000027233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027233]
Predicted Effect probably damaging
Transcript: ENSMUST00000027233
AA Change: Y338C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027233
Gene: ENSMUSG00000026065
AA Change: Y338C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Na_H_Exchanger 73 477 1.6e-90 PFAM
PDB:2E30|B 481 516 9e-8 PDB
Pfam:NEXCaM_BD 566 675 8.1e-42 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency 98% (59/60)
MGI Phenotype PHENOTYPE: Homozygous null mice display normal growth and survival but have gastric secretions with reduced acidity, mild gastric necrosis and apoptosis, and abnormal gastric mucosa with reduced numbers of parietal and chief cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T A 16: 14,411,616 V404D probably damaging Het
Adcy2 A G 13: 68,888,065 M159T possibly damaging Het
Agtpbp1 T C 13: 59,450,266 K674R probably benign Het
Atxn7 C A 14: 14,095,511 P403H probably damaging Het
Cav3 C T 6: 112,472,210 T63I probably damaging Het
Ccr6 T C 17: 8,257,066 *368Q probably null Het
Cdh8 A T 8: 99,030,763 N734K probably benign Het
Ces5a G T 8: 93,530,774 N134K probably benign Het
Cisd3 T G 11: 97,686,160 probably null Het
Cyp4f39 T G 17: 32,492,306 C476G probably damaging Het
Dffb A T 4: 153,970,092 M180K probably benign Het
Dock4 A G 12: 40,733,314 E749G possibly damaging Het
Eogt A G 6: 97,134,382 F173L possibly damaging Het
Ephb1 T A 9: 102,194,909 T224S probably benign Het
Fam114a1 A T 5: 64,979,979 E88D possibly damaging Het
Fam84b T C 15: 60,823,714 D61G probably benign Het
Fbn2 A C 18: 58,035,921 M2262R probably null Het
Fsip2 A G 2: 82,985,988 I4022V probably benign Het
Gapvd1 A G 2: 34,684,245 V1301A probably benign Het
Gch1 A T 14: 47,189,266 M1K probably null Het
Hes1 T C 16: 30,067,271 F231S probably damaging Het
Hoxb2 A G 11: 96,351,901 T31A probably benign Het
Ifngr1 T A 10: 19,607,293 V265D probably damaging Het
Ifnl3 A T 7: 28,523,007 I58F probably benign Het
Igf2r T C 17: 12,718,718 T561A probably benign Het
Igfbpl1 T A 4: 45,815,494 H214L probably damaging Het
Irf8 A G 8: 120,755,125 T318A probably benign Het
Kmt2d T C 15: 98,840,020 probably benign Het
Lrrc36 G T 8: 105,425,389 probably null Het
Msl2 C T 9: 101,101,975 P516L possibly damaging Het
Naaladl1 A T 19: 6,105,981 I62F probably damaging Het
Neto2 G T 8: 85,670,443 P60Q probably damaging Het
Nipsnap3b A T 4: 53,015,136 H61L possibly damaging Het
Npb T C 11: 120,608,647 F47L probably benign Het
Nutm1 T A 2: 112,248,559 T1004S probably benign Het
Olfr1251 T A 2: 89,667,551 I112F probably benign Het
Olfr1427 A G 19: 12,099,390 V83A probably benign Het
Olfr895 A T 9: 38,268,546 N3I probably damaging Het
Oxr1 C A 15: 41,820,555 A439E probably benign Het
Phf14 A T 6: 12,006,855 K835N probably damaging Het
Prkdc T A 16: 15,815,986 V3518E probably damaging Het
Ptpru T A 4: 131,776,352 E1132D probably damaging Het
Rapgef6 T A 11: 54,676,380 M1129K probably benign Het
Rgmb T C 17: 15,807,786 K224E probably damaging Het
Ryr3 T C 2: 112,686,825 I3318V possibly damaging Het
Smg5 T C 3: 88,349,269 probably null Het
Tenm3 A T 8: 48,240,479 Y1789* probably null Het
Tgm7 T C 2: 121,093,647 E598G probably damaging Het
Tiam1 C T 16: 89,860,204 probably null Het
Tmem175 A G 5: 108,643,082 N166S probably benign Het
Trp73 G T 4: 154,062,053 N368K probably benign Het
Trpc3 C T 3: 36,638,590 R751H probably damaging Het
Trpm4 C A 7: 45,319,280 A410S probably damaging Het
Ube2t T G 1: 134,971,357 probably null Het
Vmn2r114 C T 17: 23,310,163 A322T probably benign Het
Xylt2 C T 11: 94,667,629 R567H probably benign Het
Zfp119b T C 17: 55,939,137 K318E probably damaging Het
Zfp626 T G 7: 27,818,914 L440R probably damaging Het
Zfp850 A G 7: 27,990,514 S90P possibly damaging Het
Other mutations in Slc9a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Slc9a4 APN 1 40629405 missense probably benign 0.01
IGL01802:Slc9a4 APN 1 40607798 missense probably damaging 1.00
IGL01909:Slc9a4 APN 1 40612291 splice site probably benign
IGL02137:Slc9a4 APN 1 40600899 missense possibly damaging 0.79
IGL02399:Slc9a4 APN 1 40600782 missense probably benign 0.00
IGL02685:Slc9a4 APN 1 40629582 missense probably benign
IGL02874:Slc9a4 APN 1 40584038 missense probably benign 0.02
IGL02892:Slc9a4 APN 1 40584044 missense possibly damaging 0.64
IGL03028:Slc9a4 APN 1 40610377 missense probably benign 0.06
IGL03083:Slc9a4 APN 1 40629402 missense probably benign 0.00
IGL03124:Slc9a4 APN 1 40580735 missense probably damaging 0.99
IGL03144:Slc9a4 APN 1 40612202 missense probably damaging 1.00
IGL03286:Slc9a4 APN 1 40580768 missense probably null 0.99
R0601:Slc9a4 UTSW 1 40603070 missense probably damaging 1.00
R1118:Slc9a4 UTSW 1 40584330 splice site probably benign
R1583:Slc9a4 UTSW 1 40600962 missense probably benign 0.01
R1752:Slc9a4 UTSW 1 40629261 missense probably benign 0.00
R1776:Slc9a4 UTSW 1 40629287 missense probably benign 0.00
R1785:Slc9a4 UTSW 1 40607741 splice site probably null
R1786:Slc9a4 UTSW 1 40607741 splice site probably null
R2131:Slc9a4 UTSW 1 40607741 splice site probably null
R2132:Slc9a4 UTSW 1 40607741 splice site probably null
R2133:Slc9a4 UTSW 1 40607741 splice site probably null
R3785:Slc9a4 UTSW 1 40583970 missense probably damaging 1.00
R4223:Slc9a4 UTSW 1 40619126 missense probably damaging 0.98
R4567:Slc9a4 UTSW 1 40580577 missense probably damaging 0.99
R4605:Slc9a4 UTSW 1 40601035 splice site probably null
R4641:Slc9a4 UTSW 1 40607125 missense probably damaging 1.00
R5407:Slc9a4 UTSW 1 40607794 missense probably benign 0.41
R5823:Slc9a4 UTSW 1 40619117 missense probably damaging 0.97
R5877:Slc9a4 UTSW 1 40612263 missense probably benign
R6389:Slc9a4 UTSW 1 40580684 missense probably benign 0.00
R6430:Slc9a4 UTSW 1 40600854 nonsense probably null
R6603:Slc9a4 UTSW 1 40623504 missense probably benign 0.43
R7102:Slc9a4 UTSW 1 40580639 missense probably benign 0.00
R7102:Slc9a4 UTSW 1 40623399 missense probably damaging 1.00
R7230:Slc9a4 UTSW 1 40600771 missense probably damaging 1.00
R7313:Slc9a4 UTSW 1 40629503 missense probably benign 0.28
R7384:Slc9a4 UTSW 1 40612251 missense probably benign 0.10
R7405:Slc9a4 UTSW 1 40600926 missense probably damaging 1.00
X0060:Slc9a4 UTSW 1 40619031 splice site probably null
Predicted Primers PCR Primer
(F):5'- CATGTCACACCTGCACTTGC -3'
(R):5'- ACTGATTGCTCTCCAGATCTG -3'

Sequencing Primer
(F):5'- TTCATACACCTGGTTAAAGAGGAAG -3'
(R):5'- CCAGATCTGGCAGAAGAGC -3'
Posted On2018-11-28