Incidental Mutation 'R6950:Olfr1251'
ID541195
Institutional Source Beutler Lab
Gene Symbol Olfr1251
Ensembl Gene ENSMUSG00000111567
Gene Nameolfactory receptor 1251
SynonymsMOR231-15P, MOR231-24_p, GA_x6K02T2Q125-51109312-51108356
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.431) question?
Stock #R6950 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location89665870-89671936 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89667551 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 112 (I112F)
Ref Sequence ENSEMBL: ENSMUSP00000150028 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000214304
AA Change: I112F

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000214639
AA Change: I112F

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000214750
AA Change: I112F

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T A 16: 14,411,616 V404D probably damaging Het
Adcy2 A G 13: 68,888,065 M159T possibly damaging Het
Agtpbp1 T C 13: 59,450,266 K674R probably benign Het
Atxn7 C A 14: 14,095,511 P403H probably damaging Het
Cav3 C T 6: 112,472,210 T63I probably damaging Het
Ccr6 T C 17: 8,257,066 *368Q probably null Het
Cdh8 A T 8: 99,030,763 N734K probably benign Het
Ces5a G T 8: 93,530,774 N134K probably benign Het
Cisd3 T G 11: 97,686,160 probably null Het
Cyp4f39 T G 17: 32,492,306 C476G probably damaging Het
Dffb A T 4: 153,970,092 M180K probably benign Het
Dock4 A G 12: 40,733,314 E749G possibly damaging Het
Eogt A G 6: 97,134,382 F173L possibly damaging Het
Ephb1 T A 9: 102,194,909 T224S probably benign Het
Fam114a1 A T 5: 64,979,979 E88D possibly damaging Het
Fam84b T C 15: 60,823,714 D61G probably benign Het
Fbn2 A C 18: 58,035,921 M2262R probably null Het
Fsip2 A G 2: 82,985,988 I4022V probably benign Het
Gapvd1 A G 2: 34,684,245 V1301A probably benign Het
Gch1 A T 14: 47,189,266 M1K probably null Het
Hes1 T C 16: 30,067,271 F231S probably damaging Het
Hoxb2 A G 11: 96,351,901 T31A probably benign Het
Ifngr1 T A 10: 19,607,293 V265D probably damaging Het
Ifnl3 A T 7: 28,523,007 I58F probably benign Het
Igf2r T C 17: 12,718,718 T561A probably benign Het
Igfbpl1 T A 4: 45,815,494 H214L probably damaging Het
Irf8 A G 8: 120,755,125 T318A probably benign Het
Kmt2d T C 15: 98,840,020 probably benign Het
Lrrc36 G T 8: 105,425,389 probably null Het
Msl2 C T 9: 101,101,975 P516L possibly damaging Het
Naaladl1 A T 19: 6,105,981 I62F probably damaging Het
Neto2 G T 8: 85,670,443 P60Q probably damaging Het
Nipsnap3b A T 4: 53,015,136 H61L possibly damaging Het
Npb T C 11: 120,608,647 F47L probably benign Het
Nutm1 T A 2: 112,248,559 T1004S probably benign Het
Olfr1427 A G 19: 12,099,390 V83A probably benign Het
Olfr895 A T 9: 38,268,546 N3I probably damaging Het
Oxr1 C A 15: 41,820,555 A439E probably benign Het
Phf14 A T 6: 12,006,855 K835N probably damaging Het
Prkdc T A 16: 15,815,986 V3518E probably damaging Het
Ptpru T A 4: 131,776,352 E1132D probably damaging Het
Rapgef6 T A 11: 54,676,380 M1129K probably benign Het
Rgmb T C 17: 15,807,786 K224E probably damaging Het
Ryr3 T C 2: 112,686,825 I3318V possibly damaging Het
Slc9a4 A G 1: 40,602,885 Y338C probably damaging Het
Smg5 T C 3: 88,349,269 probably null Het
Tenm3 A T 8: 48,240,479 Y1789* probably null Het
Tgm7 T C 2: 121,093,647 E598G probably damaging Het
Tiam1 C T 16: 89,860,204 probably null Het
Tmem175 A G 5: 108,643,082 N166S probably benign Het
Trp73 G T 4: 154,062,053 N368K probably benign Het
Trpc3 C T 3: 36,638,590 R751H probably damaging Het
Trpm4 C A 7: 45,319,280 A410S probably damaging Het
Ube2t T G 1: 134,971,357 probably null Het
Vmn2r114 C T 17: 23,310,163 A322T probably benign Het
Xylt2 C T 11: 94,667,629 R567H probably benign Het
Zfp119b T C 17: 55,939,137 K318E probably damaging Het
Zfp626 T G 7: 27,818,914 L440R probably damaging Het
Zfp850 A G 7: 27,990,514 S90P possibly damaging Het
Other mutations in Olfr1251
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01817:Olfr1251 APN 2 89667004 missense probably benign 0.00
IGL01941:Olfr1251 APN 2 89667468 nonsense probably null 0.00
IGL01988:Olfr1251 APN 2 89667080 missense probably benign 0.07
IGL02388:Olfr1251 APN 2 89666972 missense probably benign 0.00
IGL03169:Olfr1251 APN 2 89667487 missense possibly damaging 0.86
R0008:Olfr1251 UTSW 2 89667084 missense probably damaging 1.00
R0042:Olfr1251 UTSW 2 89667454 missense probably benign 0.01
R0834:Olfr1251 UTSW 2 89667079 missense probably benign 0.24
R1102:Olfr1251 UTSW 2 89667470 missense probably damaging 0.98
R2213:Olfr1251 UTSW 2 89667547 missense probably damaging 1.00
R2219:Olfr1251 UTSW 2 89667867 missense possibly damaging 0.73
R3023:Olfr1251 UTSW 2 89667646 missense possibly damaging 0.86
R3105:Olfr1251 UTSW 2 89666958 missense probably benign 0.01
R3433:Olfr1251 UTSW 2 89667233 missense probably benign 0.01
R3508:Olfr1251 UTSW 2 89667472 missense probably benign 0.14
R3758:Olfr1251 UTSW 2 89667572 missense probably benign 0.14
R3909:Olfr1251 UTSW 2 89667013 missense probably damaging 0.98
R4049:Olfr1251 UTSW 2 89667662 missense probably benign 0.03
R4457:Olfr1251 UTSW 2 89667083 missense probably benign 0.24
R5613:Olfr1251 UTSW 2 89667044 missense probably damaging 1.00
R5748:Olfr1251 UTSW 2 89667802 missense possibly damaging 0.67
R6226:Olfr1251 UTSW 2 89666989 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCCAAAGTGGTCAATGATATTGG -3'
(R):5'- TAGGAACAGTGATTGCCAGC -3'

Sequencing Primer
(F):5'- TGGTCAATGATATTGGGACCAC -3'
(R):5'- ACAGTGATTGCCAGCCCCTC -3'
Posted On2018-11-28