Incidental Mutation 'R6950:Trp73'
ID541205
Institutional Source Beutler Lab
Gene Symbol Trp73
Ensembl Gene ENSMUSG00000029026
Gene Nametransformation related protein 73
SynonymsdeltaNp73, p73, TAp73
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.679) question?
Stock #R6950 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location154056253-154140208 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 154062053 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 368 (N368K)
Ref Sequence ENSEMBL: ENSMUSP00000114418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097762] [ENSMUST00000097763] [ENSMUST00000105643] [ENSMUST00000105644] [ENSMUST00000133533] [ENSMUST00000155642]
Predicted Effect probably benign
Transcript: ENSMUST00000097762
SMART Domains Protein: ENSMUSP00000095368
Gene: ENSMUSG00000029026

DomainStartEndE-ValueType
Pfam:P53 64 260 2.6e-111 PFAM
Pfam:P53_tetramer 296 337 8.5e-21 PFAM
low complexity region 342 350 N/A INTRINSIC
Pfam:SAM_2 352 406 1.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097763
SMART Domains Protein: ENSMUSP00000134196
Gene: ENSMUSG00000029026

DomainStartEndE-ValueType
Pfam:P53 64 260 6.4e-112 PFAM
Pfam:P53_tetramer 296 337 2.3e-21 PFAM
low complexity region 341 362 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105643
AA Change: N368K

PolyPhen 2 Score 0.178 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000101268
Gene: ENSMUSG00000029026
AA Change: N368K

DomainStartEndE-ValueType
Pfam:P53 64 260 2.1e-111 PFAM
Pfam:P53_tetramer 296 337 7.6e-21 PFAM
low complexity region 342 350 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105644
AA Change: N416K

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000101269
Gene: ENSMUSG00000029026
AA Change: N416K

DomainStartEndE-ValueType
Pfam:P53 112 308 3.1e-115 PFAM
Pfam:P53_tetramer 344 383 8.3e-21 PFAM
low complexity region 390 398 N/A INTRINSIC
SAM 486 552 2.71e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133533
AA Change: N368K

PolyPhen 2 Score 0.178 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000114418
Gene: ENSMUSG00000029026
AA Change: N368K

DomainStartEndE-ValueType
Pfam:P53 64 260 3.8e-111 PFAM
Pfam:P53_tetramer 296 337 1.1e-20 PFAM
low complexity region 342 350 N/A INTRINSIC
SAM 438 504 2.71e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155642
SMART Domains Protein: ENSMUSP00000135281
Gene: ENSMUSG00000029026

DomainStartEndE-ValueType
Pfam:P53 42 213 1.3e-94 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: This gene encodes tumor protein p73, which is a member of the p53 family of transcription factors involved in cellular responses to stress and development. The family members include p53, p63, and p73 and have high sequence similarity to one another, which allows p63 and p73 to transactivate p53-responsive genes causing cell cycle arrest and apoptosis. The family members can interact with each other in many ways involving direct or indirect protein interactions, resulting in regulation of the same target gene promoters or regulation of each other's promoters. The p73 protein is expressed at very low levels in normal tissues and is differentially expressed in a number of tumors. The p73 gene expresses at least 35 mRNA variants due to the use of alternate promoters, alternate translation initiation sites, and multiple splice variations. Theoretically this can account for 29 different p73 isoforms; however, the biological validity and the full-length nature of most variants have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice display a variety of defects including hippocampal dysgenesis, hydrocephalus, chronic infections and inflammation, abnormal pheromone sensory pathways, eye abnormalities, impaired growth, and female infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T A 16: 14,411,616 V404D probably damaging Het
Adcy2 A G 13: 68,888,065 M159T possibly damaging Het
Agtpbp1 T C 13: 59,450,266 K674R probably benign Het
Atxn7 C A 14: 14,095,511 P403H probably damaging Het
Cav3 C T 6: 112,472,210 T63I probably damaging Het
Ccr6 T C 17: 8,257,066 *368Q probably null Het
Cdh8 A T 8: 99,030,763 N734K probably benign Het
Ces5a G T 8: 93,530,774 N134K probably benign Het
Cisd3 T G 11: 97,686,160 probably null Het
Cyp4f39 T G 17: 32,492,306 C476G probably damaging Het
Dffb A T 4: 153,970,092 M180K probably benign Het
Dock4 A G 12: 40,733,314 E749G possibly damaging Het
Eogt A G 6: 97,134,382 F173L possibly damaging Het
Ephb1 T A 9: 102,194,909 T224S probably benign Het
Fam114a1 A T 5: 64,979,979 E88D possibly damaging Het
Fam84b T C 15: 60,823,714 D61G probably benign Het
Fbn2 A C 18: 58,035,921 M2262R probably null Het
Fsip2 A G 2: 82,985,988 I4022V probably benign Het
Gapvd1 A G 2: 34,684,245 V1301A probably benign Het
Gch1 A T 14: 47,189,266 M1K probably null Het
Hes1 T C 16: 30,067,271 F231S probably damaging Het
Hoxb2 A G 11: 96,351,901 T31A probably benign Het
Ifngr1 T A 10: 19,607,293 V265D probably damaging Het
Ifnl3 A T 7: 28,523,007 I58F probably benign Het
Igf2r T C 17: 12,718,718 T561A probably benign Het
Igfbpl1 T A 4: 45,815,494 H214L probably damaging Het
Irf8 A G 8: 120,755,125 T318A probably benign Het
Kmt2d T C 15: 98,840,020 probably benign Het
Lrrc36 G T 8: 105,425,389 probably null Het
Msl2 C T 9: 101,101,975 P516L possibly damaging Het
Naaladl1 A T 19: 6,105,981 I62F probably damaging Het
Neto2 G T 8: 85,670,443 P60Q probably damaging Het
Nipsnap3b A T 4: 53,015,136 H61L possibly damaging Het
Npb T C 11: 120,608,647 F47L probably benign Het
Nutm1 T A 2: 112,248,559 T1004S probably benign Het
Olfr1251 T A 2: 89,667,551 I112F probably benign Het
Olfr1427 A G 19: 12,099,390 V83A probably benign Het
Olfr895 A T 9: 38,268,546 N3I probably damaging Het
Oxr1 C A 15: 41,820,555 A439E probably benign Het
Phf14 A T 6: 12,006,855 K835N probably damaging Het
Prkdc T A 16: 15,815,986 V3518E probably damaging Het
Ptpru T A 4: 131,776,352 E1132D probably damaging Het
Rapgef6 T A 11: 54,676,380 M1129K probably benign Het
Rgmb T C 17: 15,807,786 K224E probably damaging Het
Ryr3 T C 2: 112,686,825 I3318V possibly damaging Het
Slc9a4 A G 1: 40,602,885 Y338C probably damaging Het
Smg5 T C 3: 88,349,269 probably null Het
Tenm3 A T 8: 48,240,479 Y1789* probably null Het
Tgm7 T C 2: 121,093,647 E598G probably damaging Het
Tiam1 C T 16: 89,860,204 probably null Het
Tmem175 A G 5: 108,643,082 N166S probably benign Het
Trpc3 C T 3: 36,638,590 R751H probably damaging Het
Trpm4 C A 7: 45,319,280 A410S probably damaging Het
Ube2t T G 1: 134,971,357 probably null Het
Vmn2r114 C T 17: 23,310,163 A322T probably benign Het
Xylt2 C T 11: 94,667,629 R567H probably benign Het
Zfp119b T C 17: 55,939,137 K318E probably damaging Het
Zfp626 T G 7: 27,818,914 L440R probably damaging Het
Zfp850 A G 7: 27,990,514 S90P possibly damaging Het
Other mutations in Trp73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02150:Trp73 APN 4 154081486 missense possibly damaging 0.82
IGL02264:Trp73 APN 4 154064428 missense probably null 0.98
IGL02344:Trp73 APN 4 154062043 missense possibly damaging 0.92
IGL02663:Trp73 APN 4 154062506 splice site probably null
IGL02956:Trp73 APN 4 154064463 splice site probably benign
IGL03093:Trp73 APN 4 154104873 missense probably benign 0.00
slowpoke UTSW 4 154064632 splice site probably null
R0238:Trp73 UTSW 4 154062524 unclassified probably benign
R0238:Trp73 UTSW 4 154062524 unclassified probably benign
R0363:Trp73 UTSW 4 154063949 missense probably benign 0.17
R0409:Trp73 UTSW 4 154064384 missense possibly damaging 0.81
R1161:Trp73 UTSW 4 154081323 splice site probably null
R1531:Trp73 UTSW 4 154063895 missense probably benign 0.31
R2002:Trp73 UTSW 4 154081445 missense probably damaging 1.00
R2185:Trp73 UTSW 4 154104817 critical splice donor site probably null
R3965:Trp73 UTSW 4 154062036 missense probably benign 0.03
R3966:Trp73 UTSW 4 154062036 missense probably benign 0.03
R4247:Trp73 UTSW 4 154064632 splice site probably null
R4595:Trp73 UTSW 4 154064417 missense probably damaging 0.99
R5170:Trp73 UTSW 4 154104838 missense possibly damaging 0.95
R5260:Trp73 UTSW 4 154062602 missense possibly damaging 0.48
R5622:Trp73 UTSW 4 154060592 missense possibly damaging 0.68
R6173:Trp73 UTSW 4 154104341 missense probably damaging 1.00
R6252:Trp73 UTSW 4 154064397 missense probably damaging 1.00
R7043:Trp73 UTSW 4 154067007 splice site probably null
R7050:Trp73 UTSW 4 154081442 missense probably damaging 1.00
R7052:Trp73 UTSW 4 154064683 missense probably damaging 0.98
R7620:Trp73 UTSW 4 154059257 nonsense probably null
R8086:Trp73 UTSW 4 154116595 missense unknown
Z1176:Trp73 UTSW 4 154067012 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTCGGTAAATCCACCCAGG -3'
(R):5'- CAAGGGCCTTGGAAATGTGG -3'

Sequencing Primer
(F):5'- GGTAAATCCACCCAGGCCCTC -3'
(R):5'- AAGGGCTGTATTTGCTGAAGC -3'
Posted On2018-11-28