Incidental Mutation 'R6950:Fam114a1'
ID541206
Institutional Source Beutler Lab
Gene Symbol Fam114a1
Ensembl Gene ENSMUSG00000029185
Gene Namefamily with sequence similarity 114, member A1
Synonyms9130005N14Rik, 1190001N04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6950 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location64970071-65041886 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 64979979 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 88 (E88D)
Ref Sequence ENSEMBL: ENSMUSP00000119284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031080] [ENSMUST00000139366]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031080
AA Change: E88D

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000031080
Gene: ENSMUSG00000029185
AA Change: E88D

DomainStartEndE-ValueType
Pfam:DUF719 125 300 5e-65 PFAM
low complexity region 355 365 N/A INTRINSIC
low complexity region 413 432 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000139366
AA Change: E88D

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119284
Gene: ENSMUSG00000029185
AA Change: E88D

DomainStartEndE-ValueType
Pfam:DUF719 121 177 7e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T A 16: 14,411,616 V404D probably damaging Het
Adcy2 A G 13: 68,888,065 M159T possibly damaging Het
Agtpbp1 T C 13: 59,450,266 K674R probably benign Het
Atxn7 C A 14: 14,095,511 P403H probably damaging Het
Cav3 C T 6: 112,472,210 T63I probably damaging Het
Ccr6 T C 17: 8,257,066 *368Q probably null Het
Cdh8 A T 8: 99,030,763 N734K probably benign Het
Ces5a G T 8: 93,530,774 N134K probably benign Het
Cisd3 T G 11: 97,686,160 probably null Het
Cyp4f39 T G 17: 32,492,306 C476G probably damaging Het
Dffb A T 4: 153,970,092 M180K probably benign Het
Dock4 A G 12: 40,733,314 E749G possibly damaging Het
Eogt A G 6: 97,134,382 F173L possibly damaging Het
Ephb1 T A 9: 102,194,909 T224S probably benign Het
Fam84b T C 15: 60,823,714 D61G probably benign Het
Fbn2 A C 18: 58,035,921 M2262R probably null Het
Fsip2 A G 2: 82,985,988 I4022V probably benign Het
Gapvd1 A G 2: 34,684,245 V1301A probably benign Het
Gch1 A T 14: 47,189,266 M1K probably null Het
Hes1 T C 16: 30,067,271 F231S probably damaging Het
Hoxb2 A G 11: 96,351,901 T31A probably benign Het
Ifngr1 T A 10: 19,607,293 V265D probably damaging Het
Ifnl3 A T 7: 28,523,007 I58F probably benign Het
Igf2r T C 17: 12,718,718 T561A probably benign Het
Igfbpl1 T A 4: 45,815,494 H214L probably damaging Het
Irf8 A G 8: 120,755,125 T318A probably benign Het
Kmt2d T C 15: 98,840,020 probably benign Het
Lrrc36 G T 8: 105,425,389 probably null Het
Msl2 C T 9: 101,101,975 P516L possibly damaging Het
Naaladl1 A T 19: 6,105,981 I62F probably damaging Het
Neto2 G T 8: 85,670,443 P60Q probably damaging Het
Nipsnap3b A T 4: 53,015,136 H61L possibly damaging Het
Npb T C 11: 120,608,647 F47L probably benign Het
Nutm1 T A 2: 112,248,559 T1004S probably benign Het
Olfr1251 T A 2: 89,667,551 I112F probably benign Het
Olfr1427 A G 19: 12,099,390 V83A probably benign Het
Olfr895 A T 9: 38,268,546 N3I probably damaging Het
Oxr1 C A 15: 41,820,555 A439E probably benign Het
Phf14 A T 6: 12,006,855 K835N probably damaging Het
Prkdc T A 16: 15,815,986 V3518E probably damaging Het
Ptpru T A 4: 131,776,352 E1132D probably damaging Het
Rapgef6 T A 11: 54,676,380 M1129K probably benign Het
Rgmb T C 17: 15,807,786 K224E probably damaging Het
Ryr3 T C 2: 112,686,825 I3318V possibly damaging Het
Slc9a4 A G 1: 40,602,885 Y338C probably damaging Het
Smg5 T C 3: 88,349,269 probably null Het
Tenm3 A T 8: 48,240,479 Y1789* probably null Het
Tgm7 T C 2: 121,093,647 E598G probably damaging Het
Tiam1 C T 16: 89,860,204 probably null Het
Tmem175 A G 5: 108,643,082 N166S probably benign Het
Trp73 G T 4: 154,062,053 N368K probably benign Het
Trpc3 C T 3: 36,638,590 R751H probably damaging Het
Trpm4 C A 7: 45,319,280 A410S probably damaging Het
Ube2t T G 1: 134,971,357 probably null Het
Vmn2r114 C T 17: 23,310,163 A322T probably benign Het
Xylt2 C T 11: 94,667,629 R567H probably benign Het
Zfp119b T C 17: 55,939,137 K318E probably damaging Het
Zfp626 T G 7: 27,818,914 L440R probably damaging Het
Zfp850 A G 7: 27,990,514 S90P possibly damaging Het
Other mutations in Fam114a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00674:Fam114a1 APN 5 64980004 missense probably benign 0.31
IGL01013:Fam114a1 APN 5 65031395 critical splice donor site probably null
IGL02032:Fam114a1 APN 5 65015371 missense probably benign 0.11
IGL02117:Fam114a1 APN 5 65030122 missense probably benign 0.08
IGL02388:Fam114a1 APN 5 65008980 unclassified probably benign
IGL02563:Fam114a1 APN 5 65006148 splice site probably null
IGL02803:Fam114a1 APN 5 65005792 splice site probably benign
R1183:Fam114a1 UTSW 5 65034388 missense probably damaging 1.00
R2073:Fam114a1 UTSW 5 64995904 critical splice donor site probably null
R2086:Fam114a1 UTSW 5 64980059 missense probably benign 0.39
R3834:Fam114a1 UTSW 5 65006073 missense possibly damaging 0.65
R4519:Fam114a1 UTSW 5 65005882 missense probably benign
R4749:Fam114a1 UTSW 5 65009066 missense probably damaging 1.00
R4937:Fam114a1 UTSW 5 64979727 missense probably damaging 0.97
R5038:Fam114a1 UTSW 5 65009045 missense probably damaging 1.00
R5096:Fam114a1 UTSW 5 64979891 missense probably benign
R5368:Fam114a1 UTSW 5 65006109 missense possibly damaging 0.52
R5460:Fam114a1 UTSW 5 65028433 missense probably damaging 0.99
R5734:Fam114a1 UTSW 5 65009046 missense probably damaging 1.00
R6242:Fam114a1 UTSW 5 65031352 missense probably damaging 0.98
R7460:Fam114a1 UTSW 5 65038707 missense possibly damaging 0.51
R7570:Fam114a1 UTSW 5 65030059 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGATGCCCAACAGTGACTCC -3'
(R):5'- AACTTATCTAGTCCGTGGTCCG -3'

Sequencing Primer
(F):5'- AGTGACTCCCCTGCTGAAGATG -3'
(R):5'- CAGAGGTATTTCAGATCCGG -3'
Posted On2018-11-28