Incidental Mutation 'R6950:Ces5a'
ID541217
Institutional Source Beutler Lab
Gene Symbol Ces5a
Ensembl Gene ENSMUSG00000058019
Gene Namecarboxylesterase 5A
SynonymsCes7, 1700122C07Rik, LOC244598, 1700081L16Rik, cauxin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R6950 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location93499064-93535830 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 93530774 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 134 (N134K)
Ref Sequence ENSEMBL: ENSMUSP00000148481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077816] [ENSMUST00000212009] [ENSMUST00000212722]
Predicted Effect probably benign
Transcript: ENSMUST00000077816
AA Change: N134K

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000076988
Gene: ENSMUSG00000058019
AA Change: N134K

DomainStartEndE-ValueType
Pfam:COesterase 10 539 3.2e-157 PFAM
Pfam:Abhydrolase_3 141 238 9.5e-7 PFAM
low complexity region 552 575 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000212009
AA Change: N134K

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000212722
AA Change: N138K

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the carboxylesterase large family. The family members are responsible for the hydrolysis or transesterification of various xenobiotics, such as cocaine and heroin, and endogenous substrates with ester, thioester, or amide bonds. They also participate in fatty acyl and cholesterol ester metabolism, and may play a role in the blood-brain barrier system. This gene, also called CES5, is predominantly expressed in peripheral tissues, including brain, kidney, lung and testis. It encodes a secreted enzyme. Because of high levels in the urine of male domestic cats, this enzyme is also called cauxin (carboxylesterase-like urinary excreted protein). The enzyme functions in regulating the production of a pheromone precursor and may contribute to lipid and cholesterol transfer processes within male reproductive fluids. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T A 16: 14,411,616 V404D probably damaging Het
Adcy2 A G 13: 68,888,065 M159T possibly damaging Het
Agtpbp1 T C 13: 59,450,266 K674R probably benign Het
Atxn7 C A 14: 14,095,511 P403H probably damaging Het
Cav3 C T 6: 112,472,210 T63I probably damaging Het
Ccr6 T C 17: 8,257,066 *368Q probably null Het
Cdh8 A T 8: 99,030,763 N734K probably benign Het
Cisd3 T G 11: 97,686,160 probably null Het
Cyp4f39 T G 17: 32,492,306 C476G probably damaging Het
Dffb A T 4: 153,970,092 M180K probably benign Het
Dock4 A G 12: 40,733,314 E749G possibly damaging Het
Eogt A G 6: 97,134,382 F173L possibly damaging Het
Ephb1 T A 9: 102,194,909 T224S probably benign Het
Fam114a1 A T 5: 64,979,979 E88D possibly damaging Het
Fam84b T C 15: 60,823,714 D61G probably benign Het
Fbn2 A C 18: 58,035,921 M2262R probably null Het
Fsip2 A G 2: 82,985,988 I4022V probably benign Het
Gapvd1 A G 2: 34,684,245 V1301A probably benign Het
Gch1 A T 14: 47,189,266 M1K probably null Het
Hes1 T C 16: 30,067,271 F231S probably damaging Het
Hoxb2 A G 11: 96,351,901 T31A probably benign Het
Ifngr1 T A 10: 19,607,293 V265D probably damaging Het
Ifnl3 A T 7: 28,523,007 I58F probably benign Het
Igf2r T C 17: 12,718,718 T561A probably benign Het
Igfbpl1 T A 4: 45,815,494 H214L probably damaging Het
Irf8 A G 8: 120,755,125 T318A probably benign Het
Kmt2d T C 15: 98,840,020 probably benign Het
Lrrc36 G T 8: 105,425,389 probably null Het
Msl2 C T 9: 101,101,975 P516L possibly damaging Het
Naaladl1 A T 19: 6,105,981 I62F probably damaging Het
Neto2 G T 8: 85,670,443 P60Q probably damaging Het
Nipsnap3b A T 4: 53,015,136 H61L possibly damaging Het
Npb T C 11: 120,608,647 F47L probably benign Het
Nutm1 T A 2: 112,248,559 T1004S probably benign Het
Olfr1251 T A 2: 89,667,551 I112F probably benign Het
Olfr1427 A G 19: 12,099,390 V83A probably benign Het
Olfr895 A T 9: 38,268,546 N3I probably damaging Het
Oxr1 C A 15: 41,820,555 A439E probably benign Het
Phf14 A T 6: 12,006,855 K835N probably damaging Het
Prkdc T A 16: 15,815,986 V3518E probably damaging Het
Ptpru T A 4: 131,776,352 E1132D probably damaging Het
Rapgef6 T A 11: 54,676,380 M1129K probably benign Het
Rgmb T C 17: 15,807,786 K224E probably damaging Het
Ryr3 T C 2: 112,686,825 I3318V possibly damaging Het
Slc9a4 A G 1: 40,602,885 Y338C probably damaging Het
Smg5 T C 3: 88,349,269 probably null Het
Tenm3 A T 8: 48,240,479 Y1789* probably null Het
Tgm7 T C 2: 121,093,647 E598G probably damaging Het
Tiam1 C T 16: 89,860,204 probably null Het
Tmem175 A G 5: 108,643,082 N166S probably benign Het
Trp73 G T 4: 154,062,053 N368K probably benign Het
Trpc3 C T 3: 36,638,590 R751H probably damaging Het
Trpm4 C A 7: 45,319,280 A410S probably damaging Het
Ube2t T G 1: 134,971,357 probably null Het
Vmn2r114 C T 17: 23,310,163 A322T probably benign Het
Xylt2 C T 11: 94,667,629 R567H probably benign Het
Zfp119b T C 17: 55,939,137 K318E probably damaging Het
Zfp626 T G 7: 27,818,914 L440R probably damaging Het
Zfp850 A G 7: 27,990,514 S90P possibly damaging Het
Other mutations in Ces5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Ces5a APN 8 93525544 critical splice donor site probably null
IGL01520:Ces5a APN 8 93519578 missense probably benign 0.08
IGL01674:Ces5a APN 8 93502219 missense probably damaging 1.00
IGL02257:Ces5a APN 8 93525598 missense probably benign 0.00
IGL02456:Ces5a APN 8 93528644 splice site probably benign
IGL03027:Ces5a APN 8 93523114 unclassified probably null
IGL03051:Ces5a APN 8 93528598 missense probably damaging 1.00
IGL03264:Ces5a APN 8 93502270 missense possibly damaging 0.74
IGL03290:Ces5a APN 8 93519632 missense probably damaging 1.00
R0115:Ces5a UTSW 8 93502183 missense probably damaging 0.98
R0124:Ces5a UTSW 8 93528555 missense probably damaging 1.00
R0521:Ces5a UTSW 8 93525658 missense probably damaging 1.00
R1404:Ces5a UTSW 8 93502181 missense probably damaging 1.00
R1404:Ces5a UTSW 8 93502181 missense probably damaging 1.00
R1524:Ces5a UTSW 8 93525665 missense probably damaging 0.96
R1843:Ces5a UTSW 8 93514231 missense probably damaging 1.00
R2029:Ces5a UTSW 8 93534577 missense probably damaging 1.00
R2135:Ces5a UTSW 8 93499741 missense probably benign 0.33
R2146:Ces5a UTSW 8 93534699 missense probably benign 0.03
R2973:Ces5a UTSW 8 93528504 missense probably damaging 1.00
R3755:Ces5a UTSW 8 93528502 missense probably benign 0.15
R4755:Ces5a UTSW 8 93535677 missense probably benign 0.39
R5072:Ces5a UTSW 8 93534668 missense probably damaging 1.00
R5278:Ces5a UTSW 8 93525638 missense probably damaging 1.00
R5419:Ces5a UTSW 8 93499431 missense unknown
R5825:Ces5a UTSW 8 93525667 missense probably damaging 1.00
R6318:Ces5a UTSW 8 93534583 missense probably damaging 1.00
R6925:Ces5a UTSW 8 93523057 intron probably null
R7148:Ces5a UTSW 8 93502322 missense probably damaging 1.00
R7256:Ces5a UTSW 8 93499526 missense probably benign 0.13
R7290:Ces5a UTSW 8 93534683 missense probably damaging 1.00
R7459:Ces5a UTSW 8 93535741 start gained probably benign
R7674:Ces5a UTSW 8 93514269 missense probably damaging 1.00
R7815:Ces5a UTSW 8 93520995 missense possibly damaging 0.79
R8150:Ces5a UTSW 8 93530802 missense probably damaging 1.00
X0024:Ces5a UTSW 8 93514213 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAATGACAGAGGACAGCTTC -3'
(R):5'- GAAGGCATGCTGACAGATGC -3'

Sequencing Primer
(F):5'- CTGCTCTACAAAGTGAGTTCCAGG -3'
(R):5'- CTGACAGATGCGGAGAGAGTAATTC -3'
Posted On2018-11-28