Incidental Mutation 'R6950:Msl2'
ID541221
Institutional Source Beutler Lab
Gene Symbol Msl2
Ensembl Gene ENSMUSG00000066415
Gene NameMSL complex subunit 2
SynonymsMsl2l1, Rnf184
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R6950 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location101074101-101104800 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 101101975 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 516 (P516L)
Ref Sequence ENSEMBL: ENSMUSP00000082270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066773] [ENSMUST00000075941] [ENSMUST00000085177] [ENSMUST00000189616]
Predicted Effect probably benign
Transcript: ENSMUST00000066773
SMART Domains Protein: ENSMUSP00000069688
Gene: ENSMUSG00000043154

DomainStartEndE-ValueType
Blast:EFh 140 169 1e-9 BLAST
Pfam:EF-hand_7 282 380 2.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075941
SMART Domains Protein: ENSMUSP00000075327
Gene: ENSMUSG00000043154

DomainStartEndE-ValueType
low complexity region 248 266 N/A INTRINSIC
Blast:EFh 760 789 1e-9 BLAST
Pfam:EF-hand_7 902 1000 2.5e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000085177
AA Change: P516L

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000082270
Gene: ENSMUSG00000066415
AA Change: P516L

DomainStartEndE-ValueType
Pfam:zf-RING_10 42 111 2.8e-36 PFAM
low complexity region 265 281 N/A INTRINSIC
low complexity region 340 351 N/A INTRINSIC
low complexity region 406 424 N/A INTRINSIC
CXC 457 504 1.6e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189616
SMART Domains Protein: ENSMUSP00000139396
Gene: ENSMUSG00000066415

DomainStartEndE-ValueType
PDB:4B86|L 1 47 2e-28 PDB
Meta Mutation Damage Score 0.4785 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T A 16: 14,411,616 V404D probably damaging Het
Adcy2 A G 13: 68,888,065 M159T possibly damaging Het
Agtpbp1 T C 13: 59,450,266 K674R probably benign Het
Atxn7 C A 14: 14,095,511 P403H probably damaging Het
Cav3 C T 6: 112,472,210 T63I probably damaging Het
Ccr6 T C 17: 8,257,066 *368Q probably null Het
Cdh8 A T 8: 99,030,763 N734K probably benign Het
Ces5a G T 8: 93,530,774 N134K probably benign Het
Cisd3 T G 11: 97,686,160 probably null Het
Cyp4f39 T G 17: 32,492,306 C476G probably damaging Het
Dffb A T 4: 153,970,092 M180K probably benign Het
Dock4 A G 12: 40,733,314 E749G possibly damaging Het
Eogt A G 6: 97,134,382 F173L possibly damaging Het
Ephb1 T A 9: 102,194,909 T224S probably benign Het
Fam114a1 A T 5: 64,979,979 E88D possibly damaging Het
Fam84b T C 15: 60,823,714 D61G probably benign Het
Fbn2 A C 18: 58,035,921 M2262R probably null Het
Fsip2 A G 2: 82,985,988 I4022V probably benign Het
Gapvd1 A G 2: 34,684,245 V1301A probably benign Het
Gch1 A T 14: 47,189,266 M1K probably null Het
Hes1 T C 16: 30,067,271 F231S probably damaging Het
Hoxb2 A G 11: 96,351,901 T31A probably benign Het
Ifngr1 T A 10: 19,607,293 V265D probably damaging Het
Ifnl3 A T 7: 28,523,007 I58F probably benign Het
Igf2r T C 17: 12,718,718 T561A probably benign Het
Igfbpl1 T A 4: 45,815,494 H214L probably damaging Het
Irf8 A G 8: 120,755,125 T318A probably benign Het
Kmt2d T C 15: 98,840,020 probably benign Het
Lrrc36 G T 8: 105,425,389 probably null Het
Naaladl1 A T 19: 6,105,981 I62F probably damaging Het
Neto2 G T 8: 85,670,443 P60Q probably damaging Het
Nipsnap3b A T 4: 53,015,136 H61L possibly damaging Het
Npb T C 11: 120,608,647 F47L probably benign Het
Nutm1 T A 2: 112,248,559 T1004S probably benign Het
Olfr1251 T A 2: 89,667,551 I112F probably benign Het
Olfr1427 A G 19: 12,099,390 V83A probably benign Het
Olfr895 A T 9: 38,268,546 N3I probably damaging Het
Oxr1 C A 15: 41,820,555 A439E probably benign Het
Phf14 A T 6: 12,006,855 K835N probably damaging Het
Prkdc T A 16: 15,815,986 V3518E probably damaging Het
Ptpru T A 4: 131,776,352 E1132D probably damaging Het
Rapgef6 T A 11: 54,676,380 M1129K probably benign Het
Rgmb T C 17: 15,807,786 K224E probably damaging Het
Ryr3 T C 2: 112,686,825 I3318V possibly damaging Het
Slc9a4 A G 1: 40,602,885 Y338C probably damaging Het
Smg5 T C 3: 88,349,269 probably null Het
Tenm3 A T 8: 48,240,479 Y1789* probably null Het
Tgm7 T C 2: 121,093,647 E598G probably damaging Het
Tiam1 C T 16: 89,860,204 probably null Het
Tmem175 A G 5: 108,643,082 N166S probably benign Het
Trp73 G T 4: 154,062,053 N368K probably benign Het
Trpc3 C T 3: 36,638,590 R751H probably damaging Het
Trpm4 C A 7: 45,319,280 A410S probably damaging Het
Ube2t T G 1: 134,971,357 probably null Het
Vmn2r114 C T 17: 23,310,163 A322T probably benign Het
Xylt2 C T 11: 94,667,629 R567H probably benign Het
Zfp119b T C 17: 55,939,137 K318E probably damaging Het
Zfp626 T G 7: 27,818,914 L440R probably damaging Het
Zfp850 A G 7: 27,990,514 S90P possibly damaging Het
Other mutations in Msl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Msl2 APN 9 101101070 missense probably benign 0.13
IGL02496:Msl2 APN 9 101100655 missense possibly damaging 0.93
IGL02798:Msl2 APN 9 101075377 missense probably benign 0.06
IGL03235:Msl2 APN 9 101100768 missense probably benign 0.03
anguished UTSW 9 101101975 missense possibly damaging 0.66
Appalled UTSW 9 101100843 missense probably benign
Crestfallen UTSW 9 101101091 nonsense probably null
R0497:Msl2 UTSW 9 101101294 missense probably benign 0.00
R1288:Msl2 UTSW 9 101102109 missense probably benign 0.01
R2015:Msl2 UTSW 9 101075251 start gained probably benign
R2038:Msl2 UTSW 9 101101984 missense probably damaging 1.00
R2238:Msl2 UTSW 9 101101370 missense probably benign 0.41
R4393:Msl2 UTSW 9 101101477 missense probably damaging 1.00
R4827:Msl2 UTSW 9 101102151 missense probably benign 0.00
R5290:Msl2 UTSW 9 101101407 unclassified probably null
R5567:Msl2 UTSW 9 101101737 missense possibly damaging 0.67
R5934:Msl2 UTSW 9 101101818 missense probably damaging 1.00
R5940:Msl2 UTSW 9 101101091 nonsense probably null
R6339:Msl2 UTSW 9 101101750 missense probably benign
R6736:Msl2 UTSW 9 101101002 missense probably damaging 0.99
R6971:Msl2 UTSW 9 101100843 missense probably benign
R7022:Msl2 UTSW 9 101075282 missense possibly damaging 0.91
R7408:Msl2 UTSW 9 101102117 missense probably benign 0.08
R8069:Msl2 UTSW 9 101100960 missense probably benign
R8281:Msl2 UTSW 9 101101695 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GCCCTACCAAGACTGTGTAC -3'
(R):5'- AGGGGTAGGTTTAAAGACCCAC -3'

Sequencing Primer
(F):5'- TGTGTACAAAAAGCCCCAGG -3'
(R):5'- GGTTTAAAGACCCACTGATTTAACAG -3'
Posted On2018-11-28