Incidental Mutation 'R6950:Xylt2'
ID541225
Institutional Source Beutler Lab
Gene Symbol Xylt2
Ensembl Gene ENSMUSG00000020868
Gene Namexylosyltransferase II
SynonymsE030002B02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.813) question?
Stock #R6950 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location94663851-94677515 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 94667629 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 567 (R567H)
Ref Sequence ENSEMBL: ENSMUSP00000122581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000116349] [ENSMUST00000146693] [ENSMUST00000150377] [ENSMUST00000153485]
Predicted Effect probably benign
Transcript: ENSMUST00000116349
AA Change: R567H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112052
Gene: ENSMUSG00000020868
AA Change: R567H

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 66 85 N/A INTRINSIC
low complexity region 102 120 N/A INTRINSIC
Pfam:Branch 234 489 1.9e-60 PFAM
Pfam:Xylo_C 519 699 1.2e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146693
Predicted Effect probably benign
Transcript: ENSMUST00000150377
SMART Domains Protein: ENSMUSP00000134495
Gene: ENSMUSG00000020868

DomainStartEndE-ValueType
Pfam:Xylo_C 31 97 2.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153485
AA Change: R567H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122581
Gene: ENSMUSG00000020868
AA Change: R567H

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 66 85 N/A INTRINSIC
low complexity region 102 120 N/A INTRINSIC
Pfam:Branch 234 489 1.1e-59 PFAM
Pfam:Xylo_C 519 594 2.4e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an isoform of xylosyltransferase, which belongs to a family of glycosyltransferases. This enzyme transfers xylose from UDP-xylose to specific serine residues of the core protein and initiates the biosynthesis of glycosaminoglycan chains in proteoglycans including chondroitin sulfate, heparan sulfate, heparin and dermatan sulfate. The enzyme activity, which is increased in scleroderma patients, is a diagnostic marker for the determination of sclerotic activity in systemic sclerosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a knock-out allele lack most liver proteoglycans and develop many aspects of polycystic liver and kidney disease, including biliary tract hyperplasia, liver fibrosis, biliary cysts, renal tubule dilation, basement membrane abnormalities and hydronephrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T A 16: 14,411,616 V404D probably damaging Het
Adcy2 A G 13: 68,888,065 M159T possibly damaging Het
Agtpbp1 T C 13: 59,450,266 K674R probably benign Het
Atxn7 C A 14: 14,095,511 P403H probably damaging Het
Cav3 C T 6: 112,472,210 T63I probably damaging Het
Ccr6 T C 17: 8,257,066 *368Q probably null Het
Cdh8 A T 8: 99,030,763 N734K probably benign Het
Ces5a G T 8: 93,530,774 N134K probably benign Het
Cisd3 T G 11: 97,686,160 probably null Het
Cyp4f39 T G 17: 32,492,306 C476G probably damaging Het
Dffb A T 4: 153,970,092 M180K probably benign Het
Dock4 A G 12: 40,733,314 E749G possibly damaging Het
Eogt A G 6: 97,134,382 F173L possibly damaging Het
Ephb1 T A 9: 102,194,909 T224S probably benign Het
Fam114a1 A T 5: 64,979,979 E88D possibly damaging Het
Fam84b T C 15: 60,823,714 D61G probably benign Het
Fbn2 A C 18: 58,035,921 M2262R probably null Het
Fsip2 A G 2: 82,985,988 I4022V probably benign Het
Gapvd1 A G 2: 34,684,245 V1301A probably benign Het
Gch1 A T 14: 47,189,266 M1K probably null Het
Hes1 T C 16: 30,067,271 F231S probably damaging Het
Hoxb2 A G 11: 96,351,901 T31A probably benign Het
Ifngr1 T A 10: 19,607,293 V265D probably damaging Het
Ifnl3 A T 7: 28,523,007 I58F probably benign Het
Igf2r T C 17: 12,718,718 T561A probably benign Het
Igfbpl1 T A 4: 45,815,494 H214L probably damaging Het
Irf8 A G 8: 120,755,125 T318A probably benign Het
Kmt2d T C 15: 98,840,020 probably benign Het
Lrrc36 G T 8: 105,425,389 probably null Het
Msl2 C T 9: 101,101,975 P516L possibly damaging Het
Naaladl1 A T 19: 6,105,981 I62F probably damaging Het
Neto2 G T 8: 85,670,443 P60Q probably damaging Het
Nipsnap3b A T 4: 53,015,136 H61L possibly damaging Het
Npb T C 11: 120,608,647 F47L probably benign Het
Nutm1 T A 2: 112,248,559 T1004S probably benign Het
Olfr1251 T A 2: 89,667,551 I112F probably benign Het
Olfr1427 A G 19: 12,099,390 V83A probably benign Het
Olfr895 A T 9: 38,268,546 N3I probably damaging Het
Oxr1 C A 15: 41,820,555 A439E probably benign Het
Phf14 A T 6: 12,006,855 K835N probably damaging Het
Prkdc T A 16: 15,815,986 V3518E probably damaging Het
Ptpru T A 4: 131,776,352 E1132D probably damaging Het
Rapgef6 T A 11: 54,676,380 M1129K probably benign Het
Rgmb T C 17: 15,807,786 K224E probably damaging Het
Ryr3 T C 2: 112,686,825 I3318V possibly damaging Het
Slc9a4 A G 1: 40,602,885 Y338C probably damaging Het
Smg5 T C 3: 88,349,269 probably null Het
Tenm3 A T 8: 48,240,479 Y1789* probably null Het
Tgm7 T C 2: 121,093,647 E598G probably damaging Het
Tiam1 C T 16: 89,860,204 probably null Het
Tmem175 A G 5: 108,643,082 N166S probably benign Het
Trp73 G T 4: 154,062,053 N368K probably benign Het
Trpc3 C T 3: 36,638,590 R751H probably damaging Het
Trpm4 C A 7: 45,319,280 A410S probably damaging Het
Ube2t T G 1: 134,971,357 probably null Het
Vmn2r114 C T 17: 23,310,163 A322T probably benign Het
Zfp119b T C 17: 55,939,137 K318E probably damaging Het
Zfp626 T G 7: 27,818,914 L440R probably damaging Het
Zfp850 A G 7: 27,990,514 S90P possibly damaging Het
Other mutations in Xylt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02048:Xylt2 APN 11 94666345 missense possibly damaging 0.61
IGL02421:Xylt2 APN 11 94667762 missense possibly damaging 0.45
P0040:Xylt2 UTSW 11 94668791 missense possibly damaging 0.46
PIT4585001:Xylt2 UTSW 11 94666240 missense probably damaging 1.00
R0016:Xylt2 UTSW 11 94669640 missense probably damaging 1.00
R0016:Xylt2 UTSW 11 94669640 missense probably damaging 1.00
R0313:Xylt2 UTSW 11 94669894 splice site probably benign
R0449:Xylt2 UTSW 11 94666333 missense probably benign 0.22
R0511:Xylt2 UTSW 11 94669936 nonsense probably null
R1483:Xylt2 UTSW 11 94669567 missense probably benign 0.04
R1511:Xylt2 UTSW 11 94670433 missense probably damaging 1.00
R1565:Xylt2 UTSW 11 94667594 missense probably benign
R1616:Xylt2 UTSW 11 94668209 missense probably damaging 1.00
R1702:Xylt2 UTSW 11 94668745 missense probably damaging 0.98
R1712:Xylt2 UTSW 11 94668749 missense possibly damaging 0.88
R2233:Xylt2 UTSW 11 94669996 missense possibly damaging 0.71
R2234:Xylt2 UTSW 11 94669996 missense possibly damaging 0.71
R4534:Xylt2 UTSW 11 94666350 missense probably benign 0.02
R4702:Xylt2 UTSW 11 94669529 missense possibly damaging 0.83
R4768:Xylt2 UTSW 11 94670472 missense probably benign 0.06
R5032:Xylt2 UTSW 11 94670016 missense probably damaging 0.99
R5237:Xylt2 UTSW 11 94667127 missense probably benign
R5281:Xylt2 UTSW 11 94668790 missense probably benign 0.30
R5949:Xylt2 UTSW 11 94668483 missense probably damaging 1.00
R7041:Xylt2 UTSW 11 94667582 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACCTCATACCCCACATGGTG -3'
(R):5'- GACTGTGAACCAGGAAGTCC -3'

Sequencing Primer
(F):5'- ACATGGTGCTGGCTCTAGC -3'
(R):5'- GAAGTCCTGGAAATTTTGGACTTCC -3'
Posted On2018-11-28