Incidental Mutation 'R0606:Zer1'
ID 54123
Institutional Source Beutler Lab
Gene Symbol Zer1
Ensembl Gene ENSMUSG00000039686
Gene Name zyg-11 related, cell cycle regulator
Synonyms Zyg11bl, C230075L19Rik
MMRRC Submission 038795-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.134) question?
Stock # R0606 (G1)
Quality Score 115
Status Validated
Chromosome 2
Chromosomal Location 29987295-30014597 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) G to T at 29994809 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044751] [ENSMUST00000113677]
AlphaFold Q80ZJ6
Predicted Effect probably benign
Transcript: ENSMUST00000044751
SMART Domains Protein: ENSMUSP00000046441
Gene: ENSMUSG00000039686

DomainStartEndE-ValueType
SCOP:d1jdha_ 405 774 3e-15 SMART
Blast:ARM 440 480 2e-18 BLAST
Blast:ARM 524 569 4e-24 BLAST
Blast:ARM 571 613 6e-22 BLAST
Blast:ARM 617 656 7e-8 BLAST
Blast:ARM 686 724 6e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000113677
SMART Domains Protein: ENSMUSP00000109307
Gene: ENSMUSG00000039686

DomainStartEndE-ValueType
SCOP:d1jdha_ 392 761 3e-15 SMART
Blast:ARM 427 467 2e-18 BLAST
Blast:ARM 511 556 4e-24 BLAST
Blast:ARM 558 600 2e-21 BLAST
Blast:ARM 604 643 7e-8 BLAST
Blast:ARM 673 711 6e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131858
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139128
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149818
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152068
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154231
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.2%
Validation Efficiency 98% (99/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of an E3 ubiquitin ligase complex that may be involved in meiosis. The encoded protein contains three leucine-rich repeat motifs. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl9 T C 17: 33,652,572 (GRCm39) Y211H probably damaging Het
Actn1 A T 12: 80,221,421 (GRCm39) probably benign Het
Adtrp A G 13: 41,920,881 (GRCm39) F197L probably damaging Het
Ankrd11 G A 8: 123,619,571 (GRCm39) T1406I probably benign Het
Arhgap24 A T 5: 103,045,086 (GRCm39) R620W probably damaging Het
Atg13 A G 2: 91,512,418 (GRCm39) Y284H probably benign Het
Atrn A G 2: 130,748,776 (GRCm39) E99G possibly damaging Het
Cage1 A T 13: 38,200,470 (GRCm39) probably benign Het
Cblif A T 19: 11,729,658 (GRCm39) I206F possibly damaging Het
Ccr3 T A 9: 123,828,839 (GRCm39) M58K probably benign Het
Cdk18 G T 1: 132,045,355 (GRCm39) probably benign Het
Chst5 A G 8: 112,617,551 (GRCm39) V23A probably benign Het
Col4a3 T C 1: 82,650,307 (GRCm39) probably benign Het
Col4a6 A G X: 139,975,219 (GRCm39) probably benign Het
Csmd3 T C 15: 48,321,058 (GRCm39) I251V probably benign Het
Csnk1g3 G A 18: 54,050,100 (GRCm39) V115M probably damaging Het
Cst7 A T 2: 150,412,439 (GRCm39) M1L probably benign Het
Cyp4f17 A T 17: 32,746,817 (GRCm39) D373V probably damaging Het
Dclk2 G A 3: 86,813,311 (GRCm39) R212W probably damaging Het
Dhrs7b T G 11: 60,721,572 (GRCm39) probably benign Het
Dhx58 T A 11: 100,593,077 (GRCm39) H210L probably benign Het
Dnah9 T C 11: 65,732,159 (GRCm39) Y4249C probably damaging Het
Eif5b T A 1: 38,087,974 (GRCm39) L990H probably damaging Het
Faap24 T C 7: 35,094,388 (GRCm39) probably benign Het
Fryl T A 5: 73,282,077 (GRCm39) H174L probably benign Het
Gabrr1 T C 4: 33,132,696 (GRCm39) W15R probably benign Het
Gm15446 T C 5: 110,091,347 (GRCm39) V533A probably benign Het
Gm6760 T A X: 63,195,259 (GRCm39) K63* probably null Het
Gne C T 4: 44,042,244 (GRCm39) E444K possibly damaging Het
Gpr173 T A X: 151,130,036 (GRCm39) M146L possibly damaging Het
Hira C T 16: 18,753,797 (GRCm39) S547L probably benign Het
Hnf1b A G 11: 83,754,810 (GRCm39) H161R probably benign Het
Hnrnpm T A 17: 33,877,364 (GRCm39) N53I probably damaging Het
Hs3st5 A T 10: 36,708,584 (GRCm39) I40F probably benign Het
Hydin C T 8: 111,276,430 (GRCm39) probably benign Het
Ift172 A G 5: 31,411,657 (GRCm39) I1607T probably damaging Het
Igfn1 T C 1: 135,887,639 (GRCm39) Q2475R probably damaging Het
Il6st T C 13: 112,640,806 (GRCm39) S800P possibly damaging Het
Iqub G A 6: 24,501,260 (GRCm39) probably benign Het
Itgb1 A T 8: 129,448,853 (GRCm39) probably benign Het
Kctd21 G A 7: 96,996,808 (GRCm39) E94K probably benign Het
Kir3dl2 A G X: 135,354,260 (GRCm39) V233A possibly damaging Het
Klra2 A T 6: 131,197,187 (GRCm39) C271S probably damaging Het
Lacc1 A T 14: 77,267,061 (GRCm39) C401S probably damaging Het
Lmna T C 3: 88,389,885 (GRCm39) E580G probably damaging Het
Matn2 A G 15: 34,345,296 (GRCm39) Y101C probably damaging Het
Mrps16 G A 14: 20,441,457 (GRCm39) R116* probably null Het
Ndrg2 G T 14: 52,143,674 (GRCm39) R333S probably damaging Het
Nf2 A G 11: 4,732,194 (GRCm39) I507T possibly damaging Het
Nktr A G 9: 121,578,356 (GRCm39) probably benign Het
Nkx3-1 G A 14: 69,428,455 (GRCm39) probably benign Het
Npat T C 9: 53,467,781 (GRCm39) probably null Het
Nrxn1 T C 17: 90,872,801 (GRCm39) N1047S probably damaging Het
Nup210 A T 6: 91,003,911 (GRCm39) I1402N possibly damaging Het
Or5d40 G T 2: 88,015,624 (GRCm39) M134I possibly damaging Het
Parp14 G A 16: 35,677,130 (GRCm39) A946V probably benign Het
Pdcl2 C T 5: 76,460,328 (GRCm39) S182N probably benign Het
Pdia3 G A 2: 121,262,858 (GRCm39) G275S probably damaging Het
Pla2g4a A G 1: 149,716,455 (GRCm39) F669L probably benign Het
Plekha8 A G 6: 54,606,805 (GRCm39) K367E probably damaging Het
Pola1 A G X: 92,531,693 (GRCm39) probably benign Het
Ppm1d C T 11: 85,236,703 (GRCm39) T494I probably benign Het
Pramel16 T A 4: 143,676,453 (GRCm39) Y217F probably benign Het
Prl6a1 A T 13: 27,498,177 (GRCm39) probably benign Het
Ptprg T A 14: 12,154,131 (GRCm38) S617R probably benign Het
R3hdm2 G A 10: 127,280,313 (GRCm39) G45D probably damaging Het
Rev1 T A 1: 38,098,204 (GRCm39) R780W probably null Het
Rnf139 T A 15: 58,771,676 (GRCm39) F567Y probably damaging Het
Scarf1 T C 11: 75,405,174 (GRCm39) V71A probably damaging Het
Shtn1 A G 19: 58,988,372 (GRCm39) S438P probably damaging Het
Slc30a3 T A 5: 31,246,067 (GRCm39) H221L probably benign Het
Smo A C 6: 29,753,603 (GRCm39) I160L possibly damaging Het
Snapc5 A T 9: 64,086,582 (GRCm39) probably benign Het
Snf8 G T 11: 95,925,799 (GRCm39) probably benign Het
Spata31d1a T C 13: 59,850,245 (GRCm39) S628G probably benign Het
Sphkap A T 1: 83,258,145 (GRCm39) D199E probably damaging Het
Spring1 T C 5: 118,397,154 (GRCm39) Y128H probably damaging Het
Stxbp5l T C 16: 37,024,883 (GRCm39) T572A possibly damaging Het
Thada C A 17: 84,723,731 (GRCm39) V1108L possibly damaging Het
Tln1 T C 4: 43,547,756 (GRCm39) Q735R probably benign Het
Trim24 G A 6: 37,848,169 (GRCm39) E42K probably benign Het
Trnt1 T A 6: 106,754,869 (GRCm39) probably benign Het
Ttbk2 A T 2: 120,604,353 (GRCm39) M215K probably damaging Het
Ttc8 C T 12: 98,909,718 (GRCm39) probably benign Het
Ube3c A G 5: 29,795,926 (GRCm39) Y105C probably damaging Het
Unc13c A G 9: 73,438,265 (GRCm39) probably benign Het
Usp36 A G 11: 118,153,854 (GRCm39) probably benign Het
Vcf2 C T X: 149,181,360 (GRCm39) A144T probably benign Het
Vmn2r102 T C 17: 19,899,106 (GRCm39) S483P possibly damaging Het
Wdr95 A G 5: 149,511,595 (GRCm39) T432A probably damaging Het
Wnk1 G T 6: 119,903,644 (GRCm39) P2523H probably damaging Het
Xpo4 A G 14: 57,875,665 (GRCm39) probably benign Het
Zar1 G T 5: 72,737,886 (GRCm39) P71Q probably damaging Het
Zbtb41 T C 1: 139,351,348 (GRCm39) Y154H probably benign Het
Zfp454 A G 11: 50,765,012 (GRCm39) F140S probably benign Het
Other mutations in Zer1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Zer1 APN 2 29,998,232 (GRCm39) critical splice donor site probably null
IGL01630:Zer1 APN 2 29,991,843 (GRCm39) missense probably damaging 1.00
IGL02126:Zer1 APN 2 29,994,928 (GRCm39) missense probably benign 0.10
IGL02338:Zer1 APN 2 30,003,405 (GRCm39) missense probably damaging 1.00
IGL02817:Zer1 APN 2 29,993,406 (GRCm39) missense probably damaging 0.99
PIT4402001:Zer1 UTSW 2 29,991,132 (GRCm39) missense probably damaging 0.96
PIT4495001:Zer1 UTSW 2 29,993,555 (GRCm39) missense probably benign 0.01
R0390:Zer1 UTSW 2 29,998,225 (GRCm39) splice site probably benign
R0506:Zer1 UTSW 2 29,991,819 (GRCm39) missense probably damaging 1.00
R0928:Zer1 UTSW 2 29,991,775 (GRCm39) critical splice donor site probably null
R1167:Zer1 UTSW 2 29,998,258 (GRCm39) missense probably benign 0.00
R1819:Zer1 UTSW 2 30,000,230 (GRCm39) missense probably benign 0.18
R2040:Zer1 UTSW 2 29,998,286 (GRCm39) missense probably damaging 1.00
R2041:Zer1 UTSW 2 29,998,286 (GRCm39) missense probably damaging 1.00
R2042:Zer1 UTSW 2 29,998,286 (GRCm39) missense probably damaging 1.00
R2092:Zer1 UTSW 2 29,998,286 (GRCm39) missense probably damaging 1.00
R2168:Zer1 UTSW 2 29,994,887 (GRCm39) missense probably damaging 1.00
R2243:Zer1 UTSW 2 29,991,139 (GRCm39) missense probably damaging 0.99
R2254:Zer1 UTSW 2 29,998,286 (GRCm39) missense probably damaging 1.00
R2255:Zer1 UTSW 2 29,998,286 (GRCm39) missense probably damaging 1.00
R2311:Zer1 UTSW 2 29,991,834 (GRCm39) missense probably damaging 0.99
R2993:Zer1 UTSW 2 29,991,909 (GRCm39) missense probably damaging 1.00
R3010:Zer1 UTSW 2 30,003,297 (GRCm39) missense probably benign 0.13
R3731:Zer1 UTSW 2 30,000,923 (GRCm39) missense probably benign 0.44
R4038:Zer1 UTSW 2 29,997,535 (GRCm39) missense probably damaging 1.00
R5241:Zer1 UTSW 2 29,994,982 (GRCm39) missense probably damaging 1.00
R5433:Zer1 UTSW 2 29,990,998 (GRCm39) intron probably benign
R5443:Zer1 UTSW 2 30,001,008 (GRCm39) missense probably damaging 1.00
R5524:Zer1 UTSW 2 29,994,866 (GRCm39) missense probably damaging 1.00
R5936:Zer1 UTSW 2 29,997,679 (GRCm39) missense probably damaging 0.97
R5999:Zer1 UTSW 2 29,995,009 (GRCm39) missense probably damaging 1.00
R6598:Zer1 UTSW 2 30,003,286 (GRCm39) missense probably damaging 1.00
R6965:Zer1 UTSW 2 29,991,059 (GRCm39) missense possibly damaging 0.87
R7030:Zer1 UTSW 2 30,001,033 (GRCm39) missense probably benign 0.00
R7190:Zer1 UTSW 2 29,993,444 (GRCm39) missense probably damaging 1.00
R7218:Zer1 UTSW 2 29,995,024 (GRCm39) missense probably damaging 1.00
R7252:Zer1 UTSW 2 29,991,904 (GRCm39) missense probably damaging 0.99
R7383:Zer1 UTSW 2 30,001,253 (GRCm39) missense probably damaging 1.00
R7417:Zer1 UTSW 2 29,992,834 (GRCm39) missense probably damaging 1.00
R7459:Zer1 UTSW 2 30,003,337 (GRCm39) missense probably damaging 1.00
R7463:Zer1 UTSW 2 30,003,449 (GRCm39) start gained probably benign
R7466:Zer1 UTSW 2 29,991,496 (GRCm39) splice site probably null
R7477:Zer1 UTSW 2 29,997,988 (GRCm39) missense probably null 0.34
R7719:Zer1 UTSW 2 30,001,243 (GRCm39) missense probably damaging 1.00
R7813:Zer1 UTSW 2 30,000,385 (GRCm39) missense probably damaging 1.00
R7976:Zer1 UTSW 2 29,997,520 (GRCm39) missense probably damaging 0.99
R8239:Zer1 UTSW 2 29,991,147 (GRCm39) critical splice acceptor site probably null
R8350:Zer1 UTSW 2 29,991,862 (GRCm39) missense probably damaging 1.00
R8404:Zer1 UTSW 2 29,995,035 (GRCm39) critical splice acceptor site probably null
R8842:Zer1 UTSW 2 30,001,062 (GRCm39) missense possibly damaging 0.65
R8896:Zer1 UTSW 2 29,993,430 (GRCm39) missense probably damaging 0.99
R8906:Zer1 UTSW 2 30,001,035 (GRCm39) missense probably benign 0.31
R8929:Zer1 UTSW 2 30,000,881 (GRCm39) missense probably damaging 1.00
R9050:Zer1 UTSW 2 30,001,294 (GRCm39) missense probably damaging 1.00
R9066:Zer1 UTSW 2 30,000,686 (GRCm39) missense probably damaging 1.00
R9277:Zer1 UTSW 2 30,001,297 (GRCm39) missense probably benign 0.00
R9322:Zer1 UTSW 2 30,000,923 (GRCm39) missense probably benign 0.00
R9577:Zer1 UTSW 2 29,991,050 (GRCm39) missense probably damaging 1.00
R9733:Zer1 UTSW 2 29,997,643 (GRCm39) missense probably benign 0.00
X0026:Zer1 UTSW 2 29,994,907 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTCATGCTCAGCCCTTAGCAATC -3'
(R):5'- CCAAATCTGTCCCTGAACGTGCTC -3'

Sequencing Primer
(F):5'- AGCCCTTAGCAATCCCCTC -3'
(R):5'- AGCGGAACTGCTGTCTGAC -3'
Posted On 2013-07-11