Incidental Mutation 'R6950:Olfr1427'
ID541249
Institutional Source Beutler Lab
Gene Symbol Olfr1427
Ensembl Gene ENSMUSG00000067525
Gene Nameolfactory receptor 1427
SynonymsMOR239-4, GA_x6K02T2RE5P-2458473-2457538
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R6950 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location12098006-12103334 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12099390 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 83 (V83A)
Ref Sequence ENSEMBL: ENSMUSP00000150457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087825] [ENSMUST00000215374] [ENSMUST00000216069]
Predicted Effect probably benign
Transcript: ENSMUST00000087825
AA Change: V83A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000085127
Gene: ENSMUSG00000067525
AA Change: V83A

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 1.4e-47 PFAM
Pfam:7tm_1 41 304 6.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215374
AA Change: V83A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000216069
AA Change: V83A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T A 16: 14,411,616 V404D probably damaging Het
Adcy2 A G 13: 68,888,065 M159T possibly damaging Het
Agtpbp1 T C 13: 59,450,266 K674R probably benign Het
Atxn7 C A 14: 14,095,511 P403H probably damaging Het
Cav3 C T 6: 112,472,210 T63I probably damaging Het
Ccr6 T C 17: 8,257,066 *368Q probably null Het
Cdh8 A T 8: 99,030,763 N734K probably benign Het
Ces5a G T 8: 93,530,774 N134K probably benign Het
Cisd3 T G 11: 97,686,160 probably null Het
Cyp4f39 T G 17: 32,492,306 C476G probably damaging Het
Dffb A T 4: 153,970,092 M180K probably benign Het
Dock4 A G 12: 40,733,314 E749G possibly damaging Het
Eogt A G 6: 97,134,382 F173L possibly damaging Het
Ephb1 T A 9: 102,194,909 T224S probably benign Het
Fam114a1 A T 5: 64,979,979 E88D possibly damaging Het
Fam84b T C 15: 60,823,714 D61G probably benign Het
Fbn2 A C 18: 58,035,921 M2262R probably null Het
Fsip2 A G 2: 82,985,988 I4022V probably benign Het
Gapvd1 A G 2: 34,684,245 V1301A probably benign Het
Gch1 A T 14: 47,189,266 M1K probably null Het
Hes1 T C 16: 30,067,271 F231S probably damaging Het
Hoxb2 A G 11: 96,351,901 T31A probably benign Het
Ifngr1 T A 10: 19,607,293 V265D probably damaging Het
Ifnl3 A T 7: 28,523,007 I58F probably benign Het
Igf2r T C 17: 12,718,718 T561A probably benign Het
Igfbpl1 T A 4: 45,815,494 H214L probably damaging Het
Irf8 A G 8: 120,755,125 T318A probably benign Het
Kmt2d T C 15: 98,840,020 probably benign Het
Lrrc36 G T 8: 105,425,389 probably null Het
Msl2 C T 9: 101,101,975 P516L possibly damaging Het
Naaladl1 A T 19: 6,105,981 I62F probably damaging Het
Neto2 G T 8: 85,670,443 P60Q probably damaging Het
Nipsnap3b A T 4: 53,015,136 H61L possibly damaging Het
Npb T C 11: 120,608,647 F47L probably benign Het
Nutm1 T A 2: 112,248,559 T1004S probably benign Het
Olfr1251 T A 2: 89,667,551 I112F probably benign Het
Olfr895 A T 9: 38,268,546 N3I probably damaging Het
Oxr1 C A 15: 41,820,555 A439E probably benign Het
Phf14 A T 6: 12,006,855 K835N probably damaging Het
Prkdc T A 16: 15,815,986 V3518E probably damaging Het
Ptpru T A 4: 131,776,352 E1132D probably damaging Het
Rapgef6 T A 11: 54,676,380 M1129K probably benign Het
Rgmb T C 17: 15,807,786 K224E probably damaging Het
Ryr3 T C 2: 112,686,825 I3318V possibly damaging Het
Slc9a4 A G 1: 40,602,885 Y338C probably damaging Het
Smg5 T C 3: 88,349,269 probably null Het
Tenm3 A T 8: 48,240,479 Y1789* probably null Het
Tgm7 T C 2: 121,093,647 E598G probably damaging Het
Tiam1 C T 16: 89,860,204 probably null Het
Tmem175 A G 5: 108,643,082 N166S probably benign Het
Trp73 G T 4: 154,062,053 N368K probably benign Het
Trpc3 C T 3: 36,638,590 R751H probably damaging Het
Trpm4 C A 7: 45,319,280 A410S probably damaging Het
Ube2t T G 1: 134,971,357 probably null Het
Vmn2r114 C T 17: 23,310,163 A322T probably benign Het
Xylt2 C T 11: 94,667,629 R567H probably benign Het
Zfp119b T C 17: 55,939,137 K318E probably damaging Het
Zfp626 T G 7: 27,818,914 L440R probably damaging Het
Zfp850 A G 7: 27,990,514 S90P possibly damaging Het
Other mutations in Olfr1427
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01322:Olfr1427 APN 19 12099405 missense probably benign 0.00
IGL01520:Olfr1427 APN 19 12099636 start codon destroyed probably null 0.98
IGL01768:Olfr1427 APN 19 12099039 missense probably damaging 1.00
IGL02060:Olfr1427 APN 19 12099460 missense probably damaging 1.00
IGL02328:Olfr1427 APN 19 12098782 missense probably damaging 1.00
R0346:Olfr1427 UTSW 19 12099439 missense probably damaging 0.96
R1264:Olfr1427 UTSW 19 12098834 missense probably benign 0.42
R1702:Olfr1427 UTSW 19 12099166 missense probably benign 0.25
R1709:Olfr1427 UTSW 19 12098881 missense probably damaging 1.00
R4781:Olfr1427 UTSW 19 12099367 missense probably benign 0.01
R4821:Olfr1427 UTSW 19 12098746 missense probably benign 0.00
R5509:Olfr1427 UTSW 19 12098977 missense possibly damaging 0.94
R5668:Olfr1427 UTSW 19 12098926 missense probably damaging 0.99
R6156:Olfr1427 UTSW 19 12099120 missense possibly damaging 0.87
R6619:Olfr1427 UTSW 19 12099363 missense probably damaging 0.99
R7008:Olfr1427 UTSW 19 12098850 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- GCCCTCTACTCATGATGGTCAC -3'
(R):5'- CTGGGAAATCACACTAAGGTGAC -3'

Sequencing Primer
(F):5'- CTCATGATGGTCACATAGTGCAG -3'
(R):5'- GTGGCCTTACCCAGTCTCAAG -3'
Posted On2018-11-28