Mutagenetix > Incidental Mutations

Incidental Mutation 'R6951:Dpp10'

541251

Institutional Source

Beutler Lab

Gene Symbol

Dpp10

Ensembl Gene

ENSMUSG00000036815

Gene Name

dipeptidylpeptidase 10

Synonyms

6430601K09Rik, DPRP3

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6951 (G1)

Quality Score

151.008

Status

Validated

Chromosome

Chromosomal Location

123321471-124045559 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 123341650 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 677 (V677M)

Ref Sequence

ENSEMBL: ENSMUSP00000108225 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112603] [ENSMUST00000112606]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112603
AA Change: V666M

PolyPhen 2 Score 0.474 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000108222
Gene: ENSMUSG00000036815
AA Change: V666M

Domain	Start	End	E-Value	Type
low complexity region	10	25	N/A	INTRINSIC
Pfam:DPPIV_N	83	450	4.9e-118	PFAM
Pfam:Peptidase_S9	530	734	6.4e-47	PFAM
Pfam:DLH	556	711	1.4e-6	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112606
AA Change: V677M

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000108225
Gene: ENSMUSG00000036815
AA Change: V677M

Domain	Start	End	E-Value	Type
transmembrane domain	38	60	N/A	INTRINSIC
low complexity region	64	79	N/A	INTRINSIC
Pfam:DPPIV_N	137	504	4.4e-115	PFAM
Pfam:Peptidase_S9	584	788	8.6e-48	PFAM
Pfam:DLH	604	774	1.1e-7	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.0%

Validation Efficiency

100% (42/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type II membrane protein that is a member of the S9B family in clan SC of the serine proteases. This protein has no detectable protease activity, most likely due to the absence of the conserved serine residue normally present in the catalytic domain of serine proteases. However, it does bind specific voltage-gated potassium channels and alters their expression and biophysical properties. Mutations in this gene have been associated with asthma. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AI314180	A	G	4: 58,853,114		probably null	Het
Ankrd34a	A	G	3: 96,598,422	N314S	possibly damaging	Het
Arhgef3	A	T	14: 27,144,018		probably benign	Het
Bmp1	T	C	14: 70,508,858	R114G	probably benign	Het
Cenpf	A	G	1: 189,653,792	L2097P	probably damaging	Het
Dapk2	C	G	9: 66,254,622	R271G	probably benign	Het
Dnase2a	A	T	8: 84,909,625	N130I	possibly damaging	Het
Dsp	G	A	13: 38,167,646	C147Y	possibly damaging	Het
Esyt2	A	G	12: 116,324,130	T223A	probably benign	Het
Fndc5	G	A	4: 129,138,780	V59I	possibly damaging	Het
Fsip2	A	G	2: 82,981,949	T2871A	possibly damaging	Het
H2-Eb1	A	T	17: 34,309,857	R121*	probably null	Het
Hydin	A	G	8: 110,398,125	I589V	probably benign	Het
Kitl	A	G	10: 100,051,852	I48V	probably damaging	Het
Large1	A	G	8: 73,116,419	S159P	probably damaging	Het
Lrba	T	C	3: 86,745,873	L2570P	probably benign	Het
Mag	G	A	7: 30,911,433	T128I	possibly damaging	Het
Mb21d1	A	G	9: 78,442,558	V174A	probably damaging	Het
Mkrn3	G	T	7: 62,419,133	D303E	possibly damaging	Het
Myo9a	A	G	9: 59,894,768	D1951G	probably damaging	Het
Nup85	C	T	11: 115,582,955	T565I	possibly damaging	Het
Olfr1077-ps1	T	C	2: 86,525,649	H176R	probably damaging	Het
Olfr1156	T	C	2: 87,949,979	I85V	possibly damaging	Het
Olfr902	A	G	9: 38,448,938	D22G	probably benign	Het
Olfr915	A	G	9: 38,646,874	S217P	probably damaging	Het
Pdzrn3	A	T	6: 101,154,192		probably null	Het
Picalm	T	A	7: 90,191,375	N434K	probably damaging	Het
Platr25	A	C	13: 62,705,748	D77E	probably benign	Het
Prr22	A	T	17: 56,772,028	R394*	probably null	Het
Psg23	A	T	7: 18,614,711	L57Q	probably damaging	Het
Rap1gap2	G	A	11: 74,484,948	S44L	possibly damaging	Het
Rffl	A	G	11: 82,845,750		probably null	Het
Stox2	G	A	8: 47,203,132	T103I	probably damaging	Het
Swt1	T	C	1: 151,397,268	N543S	possibly damaging	Het
Tep1	C	T	14: 50,833,913		probably null	Het
Tln2	A	G	9: 67,258,485	Y1023H	probably damaging	Het
Tssk5	C	A	15: 76,372,896	R262L	possibly damaging	Het
Ttn	C	T	2: 76,880,642		probably benign	Het
Ubtfl1	A	T	9: 18,409,577	I134F	probably benign	Het
Unc80	T	C	1: 66,648,511	F2351S	possibly damaging	Het
Vps13a	A	T	19: 16,723,740	D688E	probably benign	Het

Other mutations in Dpp10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01592:Dpp10	APN	1	123334370	missense	probably damaging	1.00
IGL01618:Dpp10	APN	1	123367867	missense	probably benign
IGL02101:Dpp10	APN	1	123411826	missense	probably damaging	1.00
IGL02284:Dpp10	APN	1	124045366	splice site	probably benign
IGL02324:Dpp10	APN	1	123367802	missense	probably benign	0.02
IGL02391:Dpp10	APN	1	123650358	missense	probably damaging	0.98
IGL02458:Dpp10	APN	1	123341689	missense	probably benign	0.01
IGL02469:Dpp10	APN	1	123411803	missense	probably benign	0.01
IGL02501:Dpp10	APN	1	123686270	missense	possibly damaging	0.93
IGL02522:Dpp10	APN	1	123423652	missense	probably benign	0.24
IGL02672:Dpp10	APN	1	123376647	missense	probably benign	0.45
IGL03034:Dpp10	APN	1	123341619	missense	probably damaging	1.00
PIT1430001:Dpp10	UTSW	1	123341182	splice site	probably benign
R0104:Dpp10	UTSW	1	123367843	missense	probably benign	0.00
R0114:Dpp10	UTSW	1	123486092	missense	probably benign	0.07
R0242:Dpp10	UTSW	1	123398546	missense	possibly damaging	0.56
R0242:Dpp10	UTSW	1	123398546	missense	possibly damaging	0.56
R0682:Dpp10	UTSW	1	123905125	missense	probably damaging	0.98
R0815:Dpp10	UTSW	1	123432929	critical splice donor site	probably null
R1549:Dpp10	UTSW	1	123341380	critical splice acceptor site	probably null
R1742:Dpp10	UTSW	1	123445206	missense	probably damaging	1.00
R1859:Dpp10	UTSW	1	123353604	missense	possibly damaging	0.47
R1991:Dpp10	UTSW	1	123905106	missense	probably null	1.00
R1992:Dpp10	UTSW	1	123905106	missense	probably null	1.00
R2079:Dpp10	UTSW	1	123432992	missense	probably damaging	1.00
R2882:Dpp10	UTSW	1	123445203	missense	probably damaging	1.00
R2974:Dpp10	UTSW	1	123411705	splice site	probably benign
R3827:Dpp10	UTSW	1	123411790	missense	possibly damaging	0.56
R3852:Dpp10	UTSW	1	123485924	nonsense	probably null
R3876:Dpp10	UTSW	1	123353487	missense	probably damaging	0.98
R3899:Dpp10	UTSW	1	123353557	missense	probably damaging	1.00
R4735:Dpp10	UTSW	1	123398627	missense	probably benign	0.15
R4922:Dpp10	UTSW	1	123378153	missense	probably benign	0.44
R5457:Dpp10	UTSW	1	123411810	missense	possibly damaging	0.51
R5599:Dpp10	UTSW	1	123905076	missense	probably damaging	0.99
R5913:Dpp10	UTSW	1	123384289	missense	probably damaging	1.00
R5979:Dpp10	UTSW	1	123384283	critical splice donor site	probably null
R6378:Dpp10	UTSW	1	123411739	missense	probably damaging	1.00
R6429:Dpp10	UTSW	1	123367601	missense	possibly damaging	0.72
R6505:Dpp10	UTSW	1	123336851	missense	probably damaging	0.99
R6776:Dpp10	UTSW	1	123367656	nonsense	probably null
R6894:Dpp10	UTSW	1	123336864	missense	probably damaging	1.00
R7182:Dpp10	UTSW	1	123341151	missense	probably benign	0.15
R7246:Dpp10	UTSW	1	123334377	missense	probably damaging	1.00
R7297:Dpp10	UTSW	1	123353428	nonsense	probably null
R7375:Dpp10	UTSW	1	123367795	missense	probably benign
R7387:Dpp10	UTSW	1	123341140	missense	probably benign	0.01
R7661:Dpp10	UTSW	1	123384952	missense	probably damaging	1.00
R8065:Dpp10	UTSW	1	123352660	missense	probably benign
R8067:Dpp10	UTSW	1	123352660	missense	probably benign
R8260:Dpp10	UTSW	1	123686295	missense	probably benign
R8324:Dpp10	UTSW	1	123854172	missense	probably benign	0.02
R8373:Dpp10	UTSW	1	123854229	missense	possibly damaging	0.94
R8434:Dpp10	UTSW	1	123433010	missense	probably damaging	1.00
X0019:Dpp10	UTSW	1	123398585	missense	possibly damaging	0.88
X0020:Dpp10	UTSW	1	123398582	missense	probably benign	0.36
X0021:Dpp10	UTSW	1	123432992	missense	probably damaging	1.00
X0024:Dpp10	UTSW	1	123384286	missense	probably damaging	1.00
Z1176:Dpp10	UTSW	1	123353440	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCACGCTCCAGTAAAATCAATTGC -3'
(R):5'- TTTGGAGCAATTCTAGGATACATGGTG -3'

Sequencing Primer
(F):5'- CAATTGCATAAAGGAGGTGATAACTC -3'
(R):5'- GGATACATGGTGTAAAATCATG -3'

Posted On

2018-11-28