Incidental Mutation 'R6951:Dpp10'
ID 541251
Institutional Source Beutler Lab
Gene Symbol Dpp10
Ensembl Gene ENSMUSG00000036815
Gene Name dipeptidylpeptidase 10
Synonyms 6430601K09Rik, DPRP3
MMRRC Submission 045063-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6951 (G1)
Quality Score 151.008
Status Validated
Chromosome 1
Chromosomal Location 123259871-124773774 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 123269379 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 677 (V677M)
Ref Sequence ENSEMBL: ENSMUSP00000108225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112603] [ENSMUST00000112606]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000112603
AA Change: V666M

PolyPhen 2 Score 0.474 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000108222
Gene: ENSMUSG00000036815
AA Change: V666M

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
Pfam:DPPIV_N 83 450 4.9e-118 PFAM
Pfam:Peptidase_S9 530 734 6.4e-47 PFAM
Pfam:DLH 556 711 1.4e-6 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112606
AA Change: V677M

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108225
Gene: ENSMUSG00000036815
AA Change: V677M

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
Pfam:DPPIV_N 137 504 4.4e-115 PFAM
Pfam:Peptidase_S9 584 788 8.6e-48 PFAM
Pfam:DLH 604 774 1.1e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.0%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type II membrane protein that is a member of the S9B family in clan SC of the serine proteases. This protein has no detectable protease activity, most likely due to the absence of the conserved serine residue normally present in the catalytic domain of serine proteases. However, it does bind specific voltage-gated potassium channels and alters their expression and biophysical properties. Mutations in this gene have been associated with asthma. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd34a A G 3: 96,505,738 (GRCm39) N314S possibly damaging Het
Arhgef3 A T 14: 26,865,975 (GRCm39) probably benign Het
Bmp1 T C 14: 70,746,298 (GRCm39) R114G probably benign Het
Cenpf A G 1: 189,385,989 (GRCm39) L2097P probably damaging Het
Cgas A G 9: 78,349,840 (GRCm39) V174A probably damaging Het
Dapk2 C G 9: 66,161,904 (GRCm39) R271G probably benign Het
Dnase2a A T 8: 85,636,254 (GRCm39) N130I possibly damaging Het
Dsp G A 13: 38,351,622 (GRCm39) C147Y possibly damaging Het
Ecpas A G 4: 58,853,114 (GRCm39) probably null Het
Esyt2 A G 12: 116,287,750 (GRCm39) T223A probably benign Het
Fndc5 G A 4: 129,032,573 (GRCm39) V59I possibly damaging Het
Fsip2 A G 2: 82,812,293 (GRCm39) T2871A possibly damaging Het
H2-Eb1 A T 17: 34,528,831 (GRCm39) R121* probably null Het
Hydin A G 8: 111,124,757 (GRCm39) I589V probably benign Het
Kitl A G 10: 99,887,714 (GRCm39) I48V probably damaging Het
Large1 A G 8: 73,843,047 (GRCm39) S159P probably damaging Het
Lrba T C 3: 86,653,180 (GRCm39) L2570P probably benign Het
Mag G A 7: 30,610,858 (GRCm39) T128I possibly damaging Het
Mkrn3 G T 7: 62,068,881 (GRCm39) D303E possibly damaging Het
Myo9a A G 9: 59,802,051 (GRCm39) D1951G probably damaging Het
Nup85 C T 11: 115,473,781 (GRCm39) T565I possibly damaging Het
Or5l13 T C 2: 87,780,323 (GRCm39) I85V possibly damaging Het
Or8b1d A G 9: 38,558,170 (GRCm39) S217P probably damaging Het
Or8b43 A G 9: 38,360,234 (GRCm39) D22G probably benign Het
Or8k31-ps1 T C 2: 86,355,993 (GRCm39) H176R probably damaging Het
Pdzrn3 A T 6: 101,131,153 (GRCm39) probably null Het
Picalm T A 7: 89,840,583 (GRCm39) N434K probably damaging Het
Platr25 A C 13: 62,853,562 (GRCm39) D77E probably benign Het
Prr22 A T 17: 57,079,028 (GRCm39) R394* probably null Het
Psg23 A T 7: 18,348,636 (GRCm39) L57Q probably damaging Het
Rap1gap2 G A 11: 74,375,774 (GRCm39) S44L possibly damaging Het
Rffl A G 11: 82,736,576 (GRCm39) probably null Het
Stox2 G A 8: 47,656,167 (GRCm39) T103I probably damaging Het
Swt1 T C 1: 151,273,019 (GRCm39) N543S possibly damaging Het
Tep1 C T 14: 51,071,370 (GRCm39) probably null Het
Tln2 A G 9: 67,165,767 (GRCm39) Y1023H probably damaging Het
Tssk5 C A 15: 76,257,096 (GRCm39) R262L possibly damaging Het
Ttn C T 2: 76,710,986 (GRCm39) probably benign Het
Ubtfl1 A T 9: 18,320,873 (GRCm39) I134F probably benign Het
Unc80 T C 1: 66,687,670 (GRCm39) F2351S possibly damaging Het
Vps13a A T 19: 16,701,104 (GRCm39) D688E probably benign Het
Other mutations in Dpp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01592:Dpp10 APN 1 123,262,099 (GRCm39) missense probably damaging 1.00
IGL01618:Dpp10 APN 1 123,295,596 (GRCm39) missense probably benign
IGL02101:Dpp10 APN 1 123,339,555 (GRCm39) missense probably damaging 1.00
IGL02284:Dpp10 APN 1 123,973,103 (GRCm39) splice site probably benign
IGL02324:Dpp10 APN 1 123,295,531 (GRCm39) missense probably benign 0.02
IGL02391:Dpp10 APN 1 123,578,087 (GRCm39) missense probably damaging 0.98
IGL02458:Dpp10 APN 1 123,269,418 (GRCm39) missense probably benign 0.01
IGL02469:Dpp10 APN 1 123,339,532 (GRCm39) missense probably benign 0.01
IGL02501:Dpp10 APN 1 123,613,999 (GRCm39) missense possibly damaging 0.93
IGL02522:Dpp10 APN 1 123,351,381 (GRCm39) missense probably benign 0.24
IGL02672:Dpp10 APN 1 123,304,376 (GRCm39) missense probably benign 0.45
IGL03034:Dpp10 APN 1 123,269,348 (GRCm39) missense probably damaging 1.00
PIT1430001:Dpp10 UTSW 1 123,268,911 (GRCm39) splice site probably benign
R0104:Dpp10 UTSW 1 123,295,572 (GRCm39) missense probably benign 0.00
R0114:Dpp10 UTSW 1 123,413,821 (GRCm39) missense probably benign 0.07
R0242:Dpp10 UTSW 1 123,326,275 (GRCm39) missense possibly damaging 0.56
R0242:Dpp10 UTSW 1 123,326,275 (GRCm39) missense possibly damaging 0.56
R0682:Dpp10 UTSW 1 123,832,852 (GRCm39) missense probably damaging 0.98
R0815:Dpp10 UTSW 1 123,360,658 (GRCm39) critical splice donor site probably null
R1549:Dpp10 UTSW 1 123,269,109 (GRCm39) critical splice acceptor site probably null
R1742:Dpp10 UTSW 1 123,372,935 (GRCm39) missense probably damaging 1.00
R1859:Dpp10 UTSW 1 123,281,333 (GRCm39) missense possibly damaging 0.47
R1991:Dpp10 UTSW 1 123,832,833 (GRCm39) missense probably null 1.00
R1992:Dpp10 UTSW 1 123,832,833 (GRCm39) missense probably null 1.00
R2079:Dpp10 UTSW 1 123,360,721 (GRCm39) missense probably damaging 1.00
R2882:Dpp10 UTSW 1 123,372,932 (GRCm39) missense probably damaging 1.00
R2974:Dpp10 UTSW 1 123,339,434 (GRCm39) splice site probably benign
R3827:Dpp10 UTSW 1 123,339,519 (GRCm39) missense possibly damaging 0.56
R3852:Dpp10 UTSW 1 123,413,653 (GRCm39) nonsense probably null
R3876:Dpp10 UTSW 1 123,281,216 (GRCm39) missense probably damaging 0.98
R3899:Dpp10 UTSW 1 123,281,286 (GRCm39) missense probably damaging 1.00
R4735:Dpp10 UTSW 1 123,326,356 (GRCm39) missense probably benign 0.15
R4922:Dpp10 UTSW 1 123,305,882 (GRCm39) missense probably benign 0.44
R5457:Dpp10 UTSW 1 123,339,539 (GRCm39) missense possibly damaging 0.51
R5599:Dpp10 UTSW 1 123,832,803 (GRCm39) missense probably damaging 0.99
R5913:Dpp10 UTSW 1 123,312,018 (GRCm39) missense probably damaging 1.00
R5979:Dpp10 UTSW 1 123,312,012 (GRCm39) critical splice donor site probably null
R6378:Dpp10 UTSW 1 123,339,468 (GRCm39) missense probably damaging 1.00
R6429:Dpp10 UTSW 1 123,295,330 (GRCm39) missense possibly damaging 0.72
R6505:Dpp10 UTSW 1 123,264,580 (GRCm39) missense probably damaging 0.99
R6776:Dpp10 UTSW 1 123,295,385 (GRCm39) nonsense probably null
R6894:Dpp10 UTSW 1 123,264,593 (GRCm39) missense probably damaging 1.00
R7182:Dpp10 UTSW 1 123,268,880 (GRCm39) missense probably benign 0.15
R7246:Dpp10 UTSW 1 123,262,106 (GRCm39) missense probably damaging 1.00
R7297:Dpp10 UTSW 1 123,281,157 (GRCm39) nonsense probably null
R7375:Dpp10 UTSW 1 123,295,524 (GRCm39) missense probably benign
R7387:Dpp10 UTSW 1 123,268,869 (GRCm39) missense probably benign 0.01
R7661:Dpp10 UTSW 1 123,312,681 (GRCm39) missense probably damaging 1.00
R8065:Dpp10 UTSW 1 123,280,389 (GRCm39) missense probably benign
R8067:Dpp10 UTSW 1 123,280,389 (GRCm39) missense probably benign
R8260:Dpp10 UTSW 1 123,614,024 (GRCm39) missense probably benign
R8324:Dpp10 UTSW 1 123,781,901 (GRCm39) missense probably benign 0.02
R8373:Dpp10 UTSW 1 123,781,958 (GRCm39) missense possibly damaging 0.94
R8434:Dpp10 UTSW 1 123,360,739 (GRCm39) missense probably damaging 1.00
R9068:Dpp10 UTSW 1 123,360,667 (GRCm39) missense probably damaging 1.00
R9104:Dpp10 UTSW 1 123,339,484 (GRCm39) missense probably damaging 1.00
R9477:Dpp10 UTSW 1 123,304,370 (GRCm39) missense possibly damaging 0.46
R9492:Dpp10 UTSW 1 123,281,159 (GRCm39) missense probably damaging 1.00
R9524:Dpp10 UTSW 1 123,264,611 (GRCm39) missense probably damaging 1.00
R9576:Dpp10 UTSW 1 123,269,409 (GRCm39) missense probably damaging 1.00
R9631:Dpp10 UTSW 1 123,269,432 (GRCm39) missense probably damaging 1.00
R9736:Dpp10 UTSW 1 123,262,088 (GRCm39) missense possibly damaging 0.64
X0019:Dpp10 UTSW 1 123,326,314 (GRCm39) missense possibly damaging 0.88
X0020:Dpp10 UTSW 1 123,326,311 (GRCm39) missense probably benign 0.36
X0021:Dpp10 UTSW 1 123,360,721 (GRCm39) missense probably damaging 1.00
X0024:Dpp10 UTSW 1 123,312,015 (GRCm39) missense probably damaging 1.00
Z1176:Dpp10 UTSW 1 123,281,169 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCACGCTCCAGTAAAATCAATTGC -3'
(R):5'- TTTGGAGCAATTCTAGGATACATGGTG -3'

Sequencing Primer
(F):5'- CAATTGCATAAAGGAGGTGATAACTC -3'
(R):5'- GGATACATGGTGTAAAATCATG -3'
Posted On 2018-11-28