Incidental Mutation 'R6951:Psg23'
ID541262
Institutional Source Beutler Lab
Gene Symbol Psg23
Ensembl Gene ENSMUSG00000074359
Gene Namepregnancy-specific glycoprotein 23
Synonyms1620401C02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6951 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location18606343-18616501 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 18614711 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 57 (L57Q)
Ref Sequence ENSEMBL: ENSMUSP00000056586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057810]
Predicted Effect probably damaging
Transcript: ENSMUST00000057810
AA Change: L57Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000056586
Gene: ENSMUSG00000074359
AA Change: L57Q

DomainStartEndE-ValueType
IG 39 138 2.03e-4 SMART
IG 159 260 4.16e-1 SMART
IG 276 375 1.25e-4 SMART
IGc2 393 457 4.7e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.0%
Validation Efficiency 100% (42/42)
MGI Phenotype PHENOTYPE: Mice homozygous for this spontaneous mutation display no phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI314180 A G 4: 58,853,114 probably null Het
Ankrd34a A G 3: 96,598,422 N314S possibly damaging Het
Arhgef3 A T 14: 27,144,018 probably benign Het
Bmp1 T C 14: 70,508,858 R114G probably benign Het
Cenpf A G 1: 189,653,792 L2097P probably damaging Het
Dapk2 C G 9: 66,254,622 R271G probably benign Het
Dnase2a A T 8: 84,909,625 N130I possibly damaging Het
Dpp10 C T 1: 123,341,650 V677M possibly damaging Het
Dsp G A 13: 38,167,646 C147Y possibly damaging Het
Esyt2 A G 12: 116,324,130 T223A probably benign Het
Fndc5 G A 4: 129,138,780 V59I possibly damaging Het
Fsip2 A G 2: 82,981,949 T2871A possibly damaging Het
H2-Eb1 A T 17: 34,309,857 R121* probably null Het
Hydin A G 8: 110,398,125 I589V probably benign Het
Kitl A G 10: 100,051,852 I48V probably damaging Het
Large1 A G 8: 73,116,419 S159P probably damaging Het
Lrba T C 3: 86,745,873 L2570P probably benign Het
Mag G A 7: 30,911,433 T128I possibly damaging Het
Mb21d1 A G 9: 78,442,558 V174A probably damaging Het
Mkrn3 G T 7: 62,419,133 D303E possibly damaging Het
Myo9a A G 9: 59,894,768 D1951G probably damaging Het
Nup85 C T 11: 115,582,955 T565I possibly damaging Het
Olfr1077-ps1 T C 2: 86,525,649 H176R probably damaging Het
Olfr1156 T C 2: 87,949,979 I85V possibly damaging Het
Olfr902 A G 9: 38,448,938 D22G probably benign Het
Olfr915 A G 9: 38,646,874 S217P probably damaging Het
Pdzrn3 A T 6: 101,154,192 probably null Het
Picalm T A 7: 90,191,375 N434K probably damaging Het
Platr25 A C 13: 62,705,748 D77E probably benign Het
Prr22 A T 17: 56,772,028 R394* probably null Het
Rap1gap2 G A 11: 74,484,948 S44L possibly damaging Het
Rffl A G 11: 82,845,750 probably null Het
Stox2 G A 8: 47,203,132 T103I probably damaging Het
Swt1 T C 1: 151,397,268 N543S possibly damaging Het
Tep1 C T 14: 50,833,913 probably null Het
Tln2 A G 9: 67,258,485 Y1023H probably damaging Het
Tssk5 C A 15: 76,372,896 R262L possibly damaging Het
Ttn C T 2: 76,880,642 probably benign Het
Ubtfl1 A T 9: 18,409,577 I134F probably benign Het
Unc80 T C 1: 66,648,511 F2351S possibly damaging Het
Vps13a A T 19: 16,723,740 D688E probably benign Het
Other mutations in Psg23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00814:Psg23 APN 7 18614683 nonsense probably null
IGL01309:Psg23 APN 7 18614540 missense probably damaging 1.00
IGL01736:Psg23 APN 7 18612197 missense possibly damaging 0.76
IGL02142:Psg23 APN 7 18610420 missense probably benign 0.01
IGL02728:Psg23 APN 7 18606928 missense probably benign 0.02
IGL03080:Psg23 APN 7 18606985 missense probably damaging 1.00
IGL03130:Psg23 APN 7 18610416 missense probably benign 0.25
R0113:Psg23 UTSW 7 18612002 missense probably benign 0.31
R0137:Psg23 UTSW 7 18614633 missense probably benign 0.00
R0544:Psg23 UTSW 7 18614682 missense probably damaging 1.00
R1368:Psg23 UTSW 7 18614720 missense probably benign 0.13
R1840:Psg23 UTSW 7 18610438 missense possibly damaging 0.67
R1869:Psg23 UTSW 7 18614618 missense probably benign 0.09
R1875:Psg23 UTSW 7 18610450 missense probably benign 0.10
R2041:Psg23 UTSW 7 18614778 missense possibly damaging 0.78
R2096:Psg23 UTSW 7 18614743 missense probably damaging 1.00
R3110:Psg23 UTSW 7 18610444 missense possibly damaging 0.72
R3112:Psg23 UTSW 7 18610444 missense possibly damaging 0.72
R3790:Psg23 UTSW 7 18612201 missense probably benign 0.00
R3892:Psg23 UTSW 7 18612041 missense probably damaging 1.00
R4074:Psg23 UTSW 7 18607118 missense possibly damaging 0.66
R4200:Psg23 UTSW 7 18612065 missense probably damaging 1.00
R4865:Psg23 UTSW 7 18612114 missense probably benign 0.14
R5337:Psg23 UTSW 7 18612072 missense probably benign 0.00
R6016:Psg23 UTSW 7 18612187 missense probably benign 0.00
R7033:Psg23 UTSW 7 18614744 missense possibly damaging 0.82
R7212:Psg23 UTSW 7 18607139 missense probably benign 0.00
R7427:Psg23 UTSW 7 18611983 splice site probably null
R7527:Psg23 UTSW 7 18614774 missense probably damaging 1.00
R7814:Psg23 UTSW 7 18606914 makesense probably null
R7864:Psg23 UTSW 7 18610510 missense possibly damaging 0.87
R7897:Psg23 UTSW 7 18607183 missense possibly damaging 0.83
R7947:Psg23 UTSW 7 18610510 missense possibly damaging 0.87
R7980:Psg23 UTSW 7 18607183 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TCCTGTGTGACATTTTGGATCC -3'
(R):5'- AGAAACGACACCCTCTGAGG -3'

Sequencing Primer
(F):5'- CATAGGGACCCGTTGCTGTAC -3'
(R):5'- TCATCTCTATTATGGGCACACC -3'
Posted On2018-11-28