Incidental Mutation 'R6951:Mag'
ID541263
Institutional Source Beutler Lab
Gene Symbol Mag
Ensembl Gene ENSMUSG00000036634
Gene Namemyelin-associated glycoprotein
SynonymsGma, siglec-4a
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6951 (G1)
Quality Score209.009
Status Validated
Chromosome7
Chromosomal Location30899176-30914873 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 30911433 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 128 (T128I)
Ref Sequence ENSEMBL: ENSMUSP00000139881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040548] [ENSMUST00000187137] [ENSMUST00000188569] [ENSMUST00000190638] [ENSMUST00000190950] [ENSMUST00000191081]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040548
AA Change: T128I

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000041464
Gene: ENSMUSG00000036634
AA Change: T128I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 135 1.67e0 SMART
IG 144 237 4.38e0 SMART
IGc2 252 312 5.74e-13 SMART
IGc2 338 399 7.64e-9 SMART
transmembrane domain 511 533 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000187137
AA Change: T128I

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139564
Gene: ENSMUSG00000036634
AA Change: T128I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 135 1.67e0 SMART
IG 144 237 4.38e0 SMART
IGc2 252 312 5.74e-13 SMART
IGc2 338 399 7.64e-9 SMART
transmembrane domain 511 533 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000188569
AA Change: T128I

PolyPhen 2 Score 0.504 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000140526
Gene: ENSMUSG00000036634
AA Change: T128I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 135 1.67e0 SMART
Blast:IG 152 195 1e-19 BLAST
IGc2 210 270 5.74e-13 SMART
IGc2 296 357 7.64e-9 SMART
transmembrane domain 469 491 N/A INTRINSIC
low complexity region 535 549 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000190638
AA Change: T128I

PolyPhen 2 Score 0.504 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000140578
Gene: ENSMUSG00000036634
AA Change: T128I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 135 6.7e-3 SMART
Blast:IG 144 168 5e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000190950
SMART Domains Protein: ENSMUSP00000139861
Gene: ENSMUSG00000036634

DomainStartEndE-ValueType
Blast:CLECT 1 64 3e-39 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000191081
AA Change: T128I

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139881
Gene: ENSMUSG00000036634
AA Change: T128I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 135 6.7e-3 SMART
IG 144 237 1.8e-2 SMART
IGc2 252 312 2.4e-15 SMART
IGc2 338 399 3e-11 SMART
transmembrane domain 511 533 N/A INTRINSIC
low complexity region 577 591 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.0%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: This gene encodes a type I membrane protein and member of the immunoglobulin-like superfamily. It is expressed in myelinating glial cells, including oligodendrocytes of the central nervous system and Schwann cells of the peripheral nervous system. Mice lacking the encoded protein express abundant myelin, but suffer long-term axon degeneration, altered distribution of channels and adhesion molecules at nodes of Ranvier, and altered axon cytoskeletal structure. While not required for myelination, the encoded protein enhances axon-myelin stability, helps to structure nodes of Ranvier, and regulates the axon cytoskeleton. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit delayed CNS myelination, late myelin degeneration in peripheral nerves, hypomyelination of optic nerves, and subtle intention tremors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI314180 A G 4: 58,853,114 probably null Het
Ankrd34a A G 3: 96,598,422 N314S possibly damaging Het
Arhgef3 A T 14: 27,144,018 probably benign Het
Bmp1 T C 14: 70,508,858 R114G probably benign Het
Cenpf A G 1: 189,653,792 L2097P probably damaging Het
Dapk2 C G 9: 66,254,622 R271G probably benign Het
Dnase2a A T 8: 84,909,625 N130I possibly damaging Het
Dpp10 C T 1: 123,341,650 V677M possibly damaging Het
Dsp G A 13: 38,167,646 C147Y possibly damaging Het
Esyt2 A G 12: 116,324,130 T223A probably benign Het
Fndc5 G A 4: 129,138,780 V59I possibly damaging Het
Fsip2 A G 2: 82,981,949 T2871A possibly damaging Het
H2-Eb1 A T 17: 34,309,857 R121* probably null Het
Hydin A G 8: 110,398,125 I589V probably benign Het
Kitl A G 10: 100,051,852 I48V probably damaging Het
Large1 A G 8: 73,116,419 S159P probably damaging Het
Lrba T C 3: 86,745,873 L2570P probably benign Het
Mb21d1 A G 9: 78,442,558 V174A probably damaging Het
Mkrn3 G T 7: 62,419,133 D303E possibly damaging Het
Myo9a A G 9: 59,894,768 D1951G probably damaging Het
Nup85 C T 11: 115,582,955 T565I possibly damaging Het
Olfr1077-ps1 T C 2: 86,525,649 H176R probably damaging Het
Olfr1156 T C 2: 87,949,979 I85V possibly damaging Het
Olfr902 A G 9: 38,448,938 D22G probably benign Het
Olfr915 A G 9: 38,646,874 S217P probably damaging Het
Pdzrn3 A T 6: 101,154,192 probably null Het
Picalm T A 7: 90,191,375 N434K probably damaging Het
Platr25 A C 13: 62,705,748 D77E probably benign Het
Prr22 A T 17: 56,772,028 R394* probably null Het
Psg23 A T 7: 18,614,711 L57Q probably damaging Het
Rap1gap2 G A 11: 74,484,948 S44L possibly damaging Het
Rffl A G 11: 82,845,750 probably null Het
Stox2 G A 8: 47,203,132 T103I probably damaging Het
Swt1 T C 1: 151,397,268 N543S possibly damaging Het
Tep1 C T 14: 50,833,913 probably null Het
Tln2 A G 9: 67,258,485 Y1023H probably damaging Het
Tssk5 C A 15: 76,372,896 R262L possibly damaging Het
Ttn C T 2: 76,880,642 probably benign Het
Ubtfl1 A T 9: 18,409,577 I134F probably benign Het
Unc80 T C 1: 66,648,511 F2351S possibly damaging Het
Vps13a A T 19: 16,723,740 D688E probably benign Het
Other mutations in Mag
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01716:Mag APN 7 30900387 missense probably benign 0.00
IGL02036:Mag APN 7 30908452 missense probably damaging 0.97
IGL03263:Mag APN 7 30899528 unclassified probably null
regie UTSW 7 30900729 missense probably damaging 0.98
R0005:Mag UTSW 7 30908354 splice site probably benign
R0403:Mag UTSW 7 30906980 missense probably damaging 1.00
R1590:Mag UTSW 7 30901852 missense probably damaging 0.99
R1874:Mag UTSW 7 30909051 missense probably benign 0.13
R2170:Mag UTSW 7 30908987 nonsense probably null
R2192:Mag UTSW 7 30900641 nonsense probably null
R3176:Mag UTSW 7 30901648 critical splice donor site probably null
R3177:Mag UTSW 7 30901648 critical splice donor site probably null
R3276:Mag UTSW 7 30901648 critical splice donor site probably null
R3277:Mag UTSW 7 30901648 critical splice donor site probably null
R4540:Mag UTSW 7 30900729 missense probably damaging 0.98
R4635:Mag UTSW 7 30906923 missense probably damaging 1.00
R4704:Mag UTSW 7 30909173 missense probably damaging 1.00
R4891:Mag UTSW 7 30900368 missense probably benign 0.04
R4940:Mag UTSW 7 30909200 missense probably damaging 1.00
R4952:Mag UTSW 7 30909156 nonsense probably null
R6301:Mag UTSW 7 30900679 missense probably damaging 1.00
R6441:Mag UTSW 7 30907083 missense possibly damaging 0.65
R7562:Mag UTSW 7 30909134 missense possibly damaging 0.83
R8312:Mag UTSW 7 30911469 missense probably damaging 1.00
X0024:Mag UTSW 7 30907071 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCATTCATATGGCCCACGTG -3'
(R):5'- TTTCAATAGTCCCTACCCCAAG -3'

Sequencing Primer
(F):5'- GGCACTGGGGTTTGCAC -3'
(R):5'- CAAGAACTACCCACCGGTG -3'
Posted On2018-11-28