Incidental Mutation 'R6951:Mkrn3'
ID541264
Institutional Source Beutler Lab
Gene Symbol Mkrn3
Ensembl Gene ENSMUSG00000070527
Gene Namemakorin, ring finger protein, 3
SynonymsZfp127, D7H15S9-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6951 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location62417593-62420139 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 62419133 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 303 (D303E)
Ref Sequence ENSEMBL: ENSMUSP00000091898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094340]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094340
AA Change: D303E

PolyPhen 2 Score 0.678 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000091898
Gene: ENSMUSG00000070527
AA Change: D303E

DomainStartEndE-ValueType
low complexity region 9 25 N/A INTRINSIC
low complexity region 36 46 N/A INTRINSIC
ZnF_C3H1 92 118 7.31e-8 SMART
low complexity region 156 172 N/A INTRINSIC
low complexity region 205 220 N/A INTRINSIC
ZnF_C3H1 275 300 3.95e-4 SMART
RING 347 400 5.14e-7 SMART
low complexity region 415 422 N/A INTRINSIC
ZnF_C3H1 432 458 1.16e-1 SMART
Pfam:MKRN1_C 467 542 1.3e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.0%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING (C3HC4) zinc finger motif and several C3H zinc finger motifs. This gene is intronless and imprinted, with expression only from the paternal allele. Disruption of the imprinting at this locus may contribute to Prader-Willi syndrome. An antisense RNA of unknown function has been found overlapping this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI314180 A G 4: 58,853,114 probably null Het
Ankrd34a A G 3: 96,598,422 N314S possibly damaging Het
Arhgef3 A T 14: 27,144,018 probably benign Het
Bmp1 T C 14: 70,508,858 R114G probably benign Het
Cenpf A G 1: 189,653,792 L2097P probably damaging Het
Dapk2 C G 9: 66,254,622 R271G probably benign Het
Dnase2a A T 8: 84,909,625 N130I possibly damaging Het
Dpp10 C T 1: 123,341,650 V677M possibly damaging Het
Dsp G A 13: 38,167,646 C147Y possibly damaging Het
Esyt2 A G 12: 116,324,130 T223A probably benign Het
Fndc5 G A 4: 129,138,780 V59I possibly damaging Het
Fsip2 A G 2: 82,981,949 T2871A possibly damaging Het
H2-Eb1 A T 17: 34,309,857 R121* probably null Het
Hydin A G 8: 110,398,125 I589V probably benign Het
Kitl A G 10: 100,051,852 I48V probably damaging Het
Large1 A G 8: 73,116,419 S159P probably damaging Het
Lrba T C 3: 86,745,873 L2570P probably benign Het
Mag G A 7: 30,911,433 T128I possibly damaging Het
Mb21d1 A G 9: 78,442,558 V174A probably damaging Het
Myo9a A G 9: 59,894,768 D1951G probably damaging Het
Nup85 C T 11: 115,582,955 T565I possibly damaging Het
Olfr1077-ps1 T C 2: 86,525,649 H176R probably damaging Het
Olfr1156 T C 2: 87,949,979 I85V possibly damaging Het
Olfr902 A G 9: 38,448,938 D22G probably benign Het
Olfr915 A G 9: 38,646,874 S217P probably damaging Het
Pdzrn3 A T 6: 101,154,192 probably null Het
Picalm T A 7: 90,191,375 N434K probably damaging Het
Platr25 A C 13: 62,705,748 D77E probably benign Het
Prr22 A T 17: 56,772,028 R394* probably null Het
Psg23 A T 7: 18,614,711 L57Q probably damaging Het
Rap1gap2 G A 11: 74,484,948 S44L possibly damaging Het
Rffl A G 11: 82,845,750 probably null Het
Stox2 G A 8: 47,203,132 T103I probably damaging Het
Swt1 T C 1: 151,397,268 N543S possibly damaging Het
Tep1 C T 14: 50,833,913 probably null Het
Tln2 A G 9: 67,258,485 Y1023H probably damaging Het
Tssk5 C A 15: 76,372,896 R262L possibly damaging Het
Ttn C T 2: 76,880,642 probably benign Het
Ubtfl1 A T 9: 18,409,577 I134F probably benign Het
Unc80 T C 1: 66,648,511 F2351S possibly damaging Het
Vps13a A T 19: 16,723,740 D688E probably benign Het
Other mutations in Mkrn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0558:Mkrn3 UTSW 7 62418864 missense probably benign 0.29
R1885:Mkrn3 UTSW 7 62418738 missense probably benign 0.09
R1886:Mkrn3 UTSW 7 62418738 missense probably benign 0.09
R2904:Mkrn3 UTSW 7 62418459 missense probably benign 0.38
R3117:Mkrn3 UTSW 7 62419214 small deletion probably benign
R3118:Mkrn3 UTSW 7 62419214 small deletion probably benign
R4593:Mkrn3 UTSW 7 62418804 nonsense probably null
R4654:Mkrn3 UTSW 7 62419704 missense probably damaging 1.00
R4735:Mkrn3 UTSW 7 62419704 missense probably damaging 1.00
R5528:Mkrn3 UTSW 7 62418987 missense possibly damaging 0.95
R5932:Mkrn3 UTSW 7 62418907 missense probably damaging 1.00
R5950:Mkrn3 UTSW 7 62419719 missense probably damaging 1.00
R6120:Mkrn3 UTSW 7 62419534 missense probably benign 0.00
R6618:Mkrn3 UTSW 7 62419033 missense probably benign 0.25
R7009:Mkrn3 UTSW 7 62419618 missense probably benign 0.05
R7227:Mkrn3 UTSW 7 62419667 missense probably benign 0.03
R7228:Mkrn3 UTSW 7 62419667 missense probably benign 0.03
R7286:Mkrn3 UTSW 7 62418927 missense probably benign 0.15
R7339:Mkrn3 UTSW 7 62419782 missense probably benign 0.22
R8268:Mkrn3 UTSW 7 62418522 missense probably damaging 1.00
R8366:Mkrn3 UTSW 7 62419795 missense probably benign 0.21
X0025:Mkrn3 UTSW 7 62419773 missense probably damaging 1.00
Z1176:Mkrn3 UTSW 7 62419810 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GGTCAGCTTTCTCATAGACCACC -3'
(R):5'- TTGTTCCTGGACAGCCTTAC -3'

Sequencing Primer
(F):5'- TAGACCACCTCCATGCAGATG -3'
(R):5'- TTACCGAGGTCGCATGGTC -3'
Posted On2018-11-28