Incidental Mutation 'R6951:Large1'
ID541267
Institutional Source Beutler Lab
Gene Symbol Large1
Ensembl Gene ENSMUSG00000004383
Gene NameLARGE xylosyl- and glucuronyltransferase 1
Synonymsfroggy, BPFD#36, fg, enr
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.566) question?
Stock #R6951 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location72814599-73353540 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73116419 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 159 (S159P)
Ref Sequence ENSEMBL: ENSMUSP00000148336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004497] [ENSMUST00000119826] [ENSMUST00000212459]
Predicted Effect probably damaging
Transcript: ENSMUST00000004497
AA Change: S159P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000004497
Gene: ENSMUSG00000004383
AA Change: S159P

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
coiled coil region 55 90 N/A INTRINSIC
Pfam:Glyco_transf_8 141 387 6.2e-22 PFAM
Pfam:Glyco_transf_49 473 540 5.2e-15 PFAM
Pfam:Glyco_transf_49 535 743 1.1e-47 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119826
AA Change: S159P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112617
Gene: ENSMUSG00000004383
AA Change: S159P

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
coiled coil region 55 90 N/A INTRINSIC
Pfam:Glyco_transf_8 142 386 3e-23 PFAM
Pfam:Glyco_transf_49 473 540 2.3e-11 PFAM
Pfam:Glyco_transf_49 520 743 2.7e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212459
AA Change: S159P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.9580 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.0%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, which is one of the largest in the human genome, encodes a member of the N-acetylglucosaminyltransferase gene family. It encodes a glycosyltransferase which participates in glycosylation of alpha-dystroglycan, and may carry out the synthesis of glycoprotein and glycosphingolipid sugar chains. It may also be involved in the addition of a repeated disaccharide unit. Mutations in this gene cause MDC1D, a novel form of congenital muscular dystrophy with severe mental retardation and abnormal glycosylation of alpha-dystroglycan. Alternative splicing of this gene results in two transcript variants that encode the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes exhibit a progressive myopathy, abnormal posture, thoracic kyphosis, calcium deposits in muscle, loss of Schwann cells and myelin, eye and CNS defects, deafness, reduced growth, and death around 4 months. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI314180 A G 4: 58,853,114 probably null Het
Ankrd34a A G 3: 96,598,422 N314S possibly damaging Het
Arhgef3 A T 14: 27,144,018 probably benign Het
Bmp1 T C 14: 70,508,858 R114G probably benign Het
Cenpf A G 1: 189,653,792 L2097P probably damaging Het
Dapk2 C G 9: 66,254,622 R271G probably benign Het
Dnase2a A T 8: 84,909,625 N130I possibly damaging Het
Dpp10 C T 1: 123,341,650 V677M possibly damaging Het
Dsp G A 13: 38,167,646 C147Y possibly damaging Het
Esyt2 A G 12: 116,324,130 T223A probably benign Het
Fndc5 G A 4: 129,138,780 V59I possibly damaging Het
Fsip2 A G 2: 82,981,949 T2871A possibly damaging Het
H2-Eb1 A T 17: 34,309,857 R121* probably null Het
Hydin A G 8: 110,398,125 I589V probably benign Het
Kitl A G 10: 100,051,852 I48V probably damaging Het
Lrba T C 3: 86,745,873 L2570P probably benign Het
Mag G A 7: 30,911,433 T128I possibly damaging Het
Mb21d1 A G 9: 78,442,558 V174A probably damaging Het
Mkrn3 G T 7: 62,419,133 D303E possibly damaging Het
Myo9a A G 9: 59,894,768 D1951G probably damaging Het
Nup85 C T 11: 115,582,955 T565I possibly damaging Het
Olfr1077-ps1 T C 2: 86,525,649 H176R probably damaging Het
Olfr1156 T C 2: 87,949,979 I85V possibly damaging Het
Olfr902 A G 9: 38,448,938 D22G probably benign Het
Olfr915 A G 9: 38,646,874 S217P probably damaging Het
Pdzrn3 A T 6: 101,154,192 probably null Het
Picalm T A 7: 90,191,375 N434K probably damaging Het
Platr25 A C 13: 62,705,748 D77E probably benign Het
Prr22 A T 17: 56,772,028 R394* probably null Het
Psg23 A T 7: 18,614,711 L57Q probably damaging Het
Rap1gap2 G A 11: 74,484,948 S44L possibly damaging Het
Rffl A G 11: 82,845,750 probably null Het
Stox2 G A 8: 47,203,132 T103I probably damaging Het
Swt1 T C 1: 151,397,268 N543S possibly damaging Het
Tep1 C T 14: 50,833,913 probably null Het
Tln2 A G 9: 67,258,485 Y1023H probably damaging Het
Tssk5 C A 15: 76,372,896 R262L possibly damaging Het
Ttn C T 2: 76,880,642 probably benign Het
Ubtfl1 A T 9: 18,409,577 I134F probably benign Het
Unc80 T C 1: 66,648,511 F2351S possibly damaging Het
Vps13a A T 19: 16,723,740 D688E probably benign Het
Other mutations in Large1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Large1 APN 8 72837497 missense probably damaging 1.00
IGL00326:Large1 APN 8 73131983 missense probably benign
IGL00418:Large1 APN 8 72823841 critical splice acceptor site probably null
IGL01155:Large1 APN 8 73131989 missense probably benign 0.01
IGL01793:Large1 APN 8 72859181 splice site probably benign
IGL01929:Large1 APN 8 72859275 missense probably damaging 1.00
IGL02218:Large1 APN 8 72912122 missense probably damaging 1.00
IGL02276:Large1 APN 8 72818093 missense probably benign 0.00
IGL02329:Large1 APN 8 73048317 missense possibly damaging 0.80
IGL02543:Large1 APN 8 73048414 missense probably benign 0.00
IGL02887:Large1 APN 8 73132039 missense probably benign 0.07
umber UTSW 8 72883264 nonsense probably null
R0179:Large1 UTSW 8 73098846 missense probably benign 0.09
R0477:Large1 UTSW 8 72818082 missense probably damaging 1.00
R0587:Large1 UTSW 8 72859333 missense probably damaging 1.00
R0791:Large1 UTSW 8 73048479 splice site probably benign
R1253:Large1 UTSW 8 73048422 missense probably damaging 0.98
R1695:Large1 UTSW 8 72818082 missense probably damaging 1.00
R2017:Large1 UTSW 8 72852197 missense probably damaging 1.00
R4835:Large1 UTSW 8 73048347 missense probably damaging 1.00
R5105:Large1 UTSW 8 72852244 nonsense probably null
R5120:Large1 UTSW 8 72859341 missense probably damaging 1.00
R5135:Large1 UTSW 8 72818096 missense probably benign 0.38
R5137:Large1 UTSW 8 73048309 missense possibly damaging 0.58
R5567:Large1 UTSW 8 72837453 missense possibly damaging 0.93
R5945:Large1 UTSW 8 72852200 missense probably damaging 0.99
R6619:Large1 UTSW 8 72883264 nonsense probably null
R7041:Large1 UTSW 8 73116464 missense probably damaging 0.98
R7300:Large1 UTSW 8 72837596 missense probably damaging 1.00
R7493:Large1 UTSW 8 72823715 missense probably benign 0.23
R7877:Large1 UTSW 8 73116443 missense probably damaging 1.00
R7960:Large1 UTSW 8 73116443 missense probably damaging 1.00
Z1088:Large1 UTSW 8 72912103 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTGGTAATGCTGAACCTCTGC -3'
(R):5'- AATGGCTGTATGCAGGGTC -3'

Sequencing Primer
(F):5'- GGTAATGCTGAACCTCTGCTATTAAG -3'
(R):5'- ATGCAGGGTCCTTGTTTTCTATAATC -3'
Posted On2018-11-28