Incidental Mutation 'R6951:Dnase2a'
ID541268
Institutional Source Beutler Lab
Gene Symbol Dnase2a
Ensembl Gene ENSMUSG00000003812
Gene Namedeoxyribonuclease II alpha
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6951 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location84908560-84922915 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 84909625 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 130 (N130I)
Ref Sequence ENSEMBL: ENSMUSP00000105366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003910] [ENSMUST00000067060] [ENSMUST00000109741] [ENSMUST00000109744] [ENSMUST00000119820] [ENSMUST00000134569] [ENSMUST00000145292]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003910
AA Change: N151I

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000003910
Gene: ENSMUSG00000003812
AA Change: N151I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:DNase_II 21 349 5.8e-116 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000067060
SMART Domains Protein: ENSMUSP00000064366
Gene: ENSMUSG00000054191

DomainStartEndE-ValueType
Pfam:EKLF_TAD1 40 66 9e-23 PFAM
Pfam:EKLF_TAD2 78 103 4.9e-16 PFAM
low complexity region 153 180 N/A INTRINSIC
low complexity region 197 212 N/A INTRINSIC
low complexity region 235 246 N/A INTRINSIC
ZnF_C2H2 293 317 2.2e-2 SMART
ZnF_C2H2 323 347 7.49e-5 SMART
ZnF_C2H2 353 375 3.34e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109741
SMART Domains Protein: ENSMUSP00000105363
Gene: ENSMUSG00000053693

DomainStartEndE-ValueType
Pfam:DUF1908 61 337 1.4e-136 PFAM
S_TKc 376 649 4.07e-97 SMART
S_TK_X 650 710 6.23e-2 SMART
low complexity region 820 836 N/A INTRINSIC
low complexity region 863 878 N/A INTRINSIC
low complexity region 933 961 N/A INTRINSIC
PDZ 977 1057 3.49e-14 SMART
low complexity region 1104 1132 N/A INTRINSIC
low complexity region 1149 1174 N/A INTRINSIC
low complexity region 1212 1224 N/A INTRINSIC
low complexity region 1243 1252 N/A INTRINSIC
low complexity region 1479 1492 N/A INTRINSIC
low complexity region 1519 1535 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109744
AA Change: N130I

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105366
Gene: ENSMUSG00000003812
AA Change: N130I

DomainStartEndE-ValueType
Pfam:DNase_II 9 328 4.8e-114 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119820
SMART Domains Protein: ENSMUSP00000113547
Gene: ENSMUSG00000053693

DomainStartEndE-ValueType
Pfam:DUF1908 61 338 5.1e-148 PFAM
S_TKc 376 644 2.79e-86 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134569
SMART Domains Protein: ENSMUSP00000117198
Gene: ENSMUSG00000003812

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:DNase_II 20 119 6.6e-32 PFAM
Pfam:DNase_II 115 182 4.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145292
AA Change: M125L

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000138203
Gene: ENSMUSG00000003812
AA Change: M125L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:DNase_II 20 97 2.4e-21 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.0%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNase family. The protein, located in the lysosome, hydrolyzes DNA under acidic conditions and mediates the breakdown of DNA during erythropoiesis and apoptosis. Two codominant alleles have been characterized, DNASE2*L (low activity) and DNASE2*H (high activity), that differ at one nucleotide in the promoter region. The DNASE2*H allele is represented in this record. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted mutations of this gene result in perinatal death, anemia, and impaired definitive erythropoiesis in the fetal liver. Homozygotes for one null mutation display diaphragm abnormalities and asphyxiation, as well as a specific defect in the phagocytic phase of apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI314180 A G 4: 58,853,114 probably null Het
Ankrd34a A G 3: 96,598,422 N314S possibly damaging Het
Arhgef3 A T 14: 27,144,018 probably benign Het
Bmp1 T C 14: 70,508,858 R114G probably benign Het
Cenpf A G 1: 189,653,792 L2097P probably damaging Het
Dapk2 C G 9: 66,254,622 R271G probably benign Het
Dpp10 C T 1: 123,341,650 V677M possibly damaging Het
Dsp G A 13: 38,167,646 C147Y possibly damaging Het
Esyt2 A G 12: 116,324,130 T223A probably benign Het
Fndc5 G A 4: 129,138,780 V59I possibly damaging Het
Fsip2 A G 2: 82,981,949 T2871A possibly damaging Het
H2-Eb1 A T 17: 34,309,857 R121* probably null Het
Hydin A G 8: 110,398,125 I589V probably benign Het
Kitl A G 10: 100,051,852 I48V probably damaging Het
Large1 A G 8: 73,116,419 S159P probably damaging Het
Lrba T C 3: 86,745,873 L2570P probably benign Het
Mag G A 7: 30,911,433 T128I possibly damaging Het
Mb21d1 A G 9: 78,442,558 V174A probably damaging Het
Mkrn3 G T 7: 62,419,133 D303E possibly damaging Het
Myo9a A G 9: 59,894,768 D1951G probably damaging Het
Nup85 C T 11: 115,582,955 T565I possibly damaging Het
Olfr1077-ps1 T C 2: 86,525,649 H176R probably damaging Het
Olfr1156 T C 2: 87,949,979 I85V possibly damaging Het
Olfr902 A G 9: 38,448,938 D22G probably benign Het
Olfr915 A G 9: 38,646,874 S217P probably damaging Het
Pdzrn3 A T 6: 101,154,192 probably null Het
Picalm T A 7: 90,191,375 N434K probably damaging Het
Platr25 A C 13: 62,705,748 D77E probably benign Het
Prr22 A T 17: 56,772,028 R394* probably null Het
Psg23 A T 7: 18,614,711 L57Q probably damaging Het
Rap1gap2 G A 11: 74,484,948 S44L possibly damaging Het
Rffl A G 11: 82,845,750 probably null Het
Stox2 G A 8: 47,203,132 T103I probably damaging Het
Swt1 T C 1: 151,397,268 N543S possibly damaging Het
Tep1 C T 14: 50,833,913 probably null Het
Tln2 A G 9: 67,258,485 Y1023H probably damaging Het
Tssk5 C A 15: 76,372,896 R262L possibly damaging Het
Ttn C T 2: 76,880,642 probably benign Het
Ubtfl1 A T 9: 18,409,577 I134F probably benign Het
Unc80 T C 1: 66,648,511 F2351S possibly damaging Het
Vps13a A T 19: 16,723,740 D688E probably benign Het
Other mutations in Dnase2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0211:Dnase2a UTSW 8 84908788 unclassified probably benign
R0211:Dnase2a UTSW 8 84908788 unclassified probably benign
R0396:Dnase2a UTSW 8 84909763 splice site probably benign
R1845:Dnase2a UTSW 8 84909322 missense probably benign 0.19
R1870:Dnase2a UTSW 8 84908763 start gained probably benign
R1939:Dnase2a UTSW 8 84910895 missense possibly damaging 0.83
R2113:Dnase2a UTSW 8 84910871 missense probably damaging 0.99
R2442:Dnase2a UTSW 8 84908993 missense probably damaging 1.00
R4815:Dnase2a UTSW 8 84909877 missense probably benign 0.12
R4913:Dnase2a UTSW 8 84908848 missense probably damaging 1.00
R4922:Dnase2a UTSW 8 84908996 unclassified probably null
R5183:Dnase2a UTSW 8 84909578 intron probably benign
R6239:Dnase2a UTSW 8 84908879 splice site probably null
R7215:Dnase2a UTSW 8 84909770 critical splice acceptor site probably null
R7789:Dnase2a UTSW 8 84908876 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCTAAGACCCCAGCCATCTGAG -3'
(R):5'- ATCACCGTCTCTAGGTCAGG -3'

Sequencing Primer
(F):5'- ATCTGAGGCCCCGTACCTG -3'
(R):5'- TTCTGAGCGAAGAAGCCTTC -3'
Posted On2018-11-28