Incidental Mutation 'R6951:Ubtfl1'
ID541270
Institutional Source Beutler Lab
Gene Symbol Ubtfl1
Ensembl Gene ENSMUSG00000074502
Gene Nameupstream binding transcription factor, RNA polymerase I-like 1
SynonymsHmgpi, B020006M18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R6951 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location18404418-18413177 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 18409577 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 134 (I134F)
Ref Sequence ENSEMBL: ENSMUSP00000126540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098973] [ENSMUST00000164441] [ENSMUST00000169398]
Predicted Effect probably benign
Transcript: ENSMUST00000098973
AA Change: I134F

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000096572
Gene: ENSMUSG00000074502
AA Change: I134F

DomainStartEndE-ValueType
Blast:SANT 6 64 1e-17 BLAST
HMG 100 170 5.61e-16 SMART
HMG 224 292 3.79e-4 SMART
low complexity region 297 307 N/A INTRINSIC
low complexity region 373 394 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164441
AA Change: I134F

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000129611
Gene: ENSMUSG00000074502
AA Change: I134F

DomainStartEndE-ValueType
Blast:SANT 6 64 1e-17 BLAST
HMG 100 170 5.61e-16 SMART
HMG 224 292 3.79e-4 SMART
low complexity region 297 307 N/A INTRINSIC
low complexity region 373 394 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169398
AA Change: I134F

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000126540
Gene: ENSMUSG00000074502
AA Change: I134F

DomainStartEndE-ValueType
Blast:SANT 6 64 1e-17 BLAST
HMG 100 170 5.61e-16 SMART
HMG 224 292 3.79e-4 SMART
low complexity region 297 307 N/A INTRINSIC
low complexity region 373 394 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.0%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI314180 A G 4: 58,853,114 probably null Het
Ankrd34a A G 3: 96,598,422 N314S possibly damaging Het
Arhgef3 A T 14: 27,144,018 probably benign Het
Bmp1 T C 14: 70,508,858 R114G probably benign Het
Cenpf A G 1: 189,653,792 L2097P probably damaging Het
Dapk2 C G 9: 66,254,622 R271G probably benign Het
Dnase2a A T 8: 84,909,625 N130I possibly damaging Het
Dpp10 C T 1: 123,341,650 V677M possibly damaging Het
Dsp G A 13: 38,167,646 C147Y possibly damaging Het
Esyt2 A G 12: 116,324,130 T223A probably benign Het
Fndc5 G A 4: 129,138,780 V59I possibly damaging Het
Fsip2 A G 2: 82,981,949 T2871A possibly damaging Het
H2-Eb1 A T 17: 34,309,857 R121* probably null Het
Hydin A G 8: 110,398,125 I589V probably benign Het
Kitl A G 10: 100,051,852 I48V probably damaging Het
Large1 A G 8: 73,116,419 S159P probably damaging Het
Lrba T C 3: 86,745,873 L2570P probably benign Het
Mag G A 7: 30,911,433 T128I possibly damaging Het
Mb21d1 A G 9: 78,442,558 V174A probably damaging Het
Mkrn3 G T 7: 62,419,133 D303E possibly damaging Het
Myo9a A G 9: 59,894,768 D1951G probably damaging Het
Nup85 C T 11: 115,582,955 T565I possibly damaging Het
Olfr1077-ps1 T C 2: 86,525,649 H176R probably damaging Het
Olfr1156 T C 2: 87,949,979 I85V possibly damaging Het
Olfr902 A G 9: 38,448,938 D22G probably benign Het
Olfr915 A G 9: 38,646,874 S217P probably damaging Het
Pdzrn3 A T 6: 101,154,192 probably null Het
Picalm T A 7: 90,191,375 N434K probably damaging Het
Platr25 A C 13: 62,705,748 D77E probably benign Het
Prr22 A T 17: 56,772,028 R394* probably null Het
Psg23 A T 7: 18,614,711 L57Q probably damaging Het
Rap1gap2 G A 11: 74,484,948 S44L possibly damaging Het
Rffl A G 11: 82,845,750 probably null Het
Stox2 G A 8: 47,203,132 T103I probably damaging Het
Swt1 T C 1: 151,397,268 N543S possibly damaging Het
Tep1 C T 14: 50,833,913 probably null Het
Tln2 A G 9: 67,258,485 Y1023H probably damaging Het
Tssk5 C A 15: 76,372,896 R262L possibly damaging Het
Ttn C T 2: 76,880,642 probably benign Het
Unc80 T C 1: 66,648,511 F2351S possibly damaging Het
Vps13a A T 19: 16,723,740 D688E probably benign Het
Other mutations in Ubtfl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01886:Ubtfl1 APN 9 18409721 missense possibly damaging 0.93
IGL02028:Ubtfl1 APN 9 18409553 missense possibly damaging 0.83
R0112:Ubtfl1 UTSW 9 18409787 missense probably benign 0.24
R0600:Ubtfl1 UTSW 9 18409364 missense probably damaging 1.00
R1450:Ubtfl1 UTSW 9 18409913 missense possibly damaging 0.54
R1511:Ubtfl1 UTSW 9 18410193 missense probably benign 0.00
R2007:Ubtfl1 UTSW 9 18409251 missense possibly damaging 0.93
R3611:Ubtfl1 UTSW 9 18409365 missense probably damaging 1.00
R3836:Ubtfl1 UTSW 9 18409237 missense possibly damaging 0.67
R4088:Ubtfl1 UTSW 9 18409968 missense probably damaging 0.98
R4577:Ubtfl1 UTSW 9 18409493 missense probably damaging 1.00
R5057:Ubtfl1 UTSW 9 18409191 missense possibly damaging 0.83
R5224:Ubtfl1 UTSW 9 18410030 missense probably benign 0.34
R5284:Ubtfl1 UTSW 9 18409445 nonsense probably null
R5965:Ubtfl1 UTSW 9 18409542 missense probably benign 0.04
R6261:Ubtfl1 UTSW 9 18409296 missense possibly damaging 0.65
R6449:Ubtfl1 UTSW 9 18409629 missense possibly damaging 0.88
R7130:Ubtfl1 UTSW 9 18409847 missense probably damaging 1.00
R7133:Ubtfl1 UTSW 9 18409635 missense probably damaging 1.00
R7664:Ubtfl1 UTSW 9 18409486 missense possibly damaging 0.66
R7718:Ubtfl1 UTSW 9 18409231 missense possibly damaging 0.77
R8171:Ubtfl1 UTSW 9 18409227 missense probably benign 0.09
R8789:Ubtfl1 UTSW 9 18410313 missense unknown
R8811:Ubtfl1 UTSW 9 18410163 missense probably benign
Z1177:Ubtfl1 UTSW 9 18409667 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAAGTTCCGCACACTGAC -3'
(R):5'- AGAAACTGTTCTGGGAGATTCTG -3'

Sequencing Primer
(F):5'- GTTCCGCACACTGACAGAATTAGTG -3'
(R):5'- ATATCTCCTTGTGACTTCGTAGGGAC -3'
Posted On2018-11-28