Incidental Mutation 'R6951:Dapk2'
ID541274
Institutional Source Beutler Lab
Gene Symbol Dapk2
Ensembl Gene ENSMUSG00000032380
Gene Namedeath-associated protein kinase 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6951 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location66158223-66272242 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 66254622 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 271 (R271G)
Ref Sequence ENSEMBL: ENSMUSP00000034944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034944]
PDB Structure
CRYSTAL STRUCTURE OF THE AUTOINHIBITED FORM OF MOUSE DAPK2 [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE AUTOINHIBITED FORM OF MOUSE DAPK2 IN COMPLEX WITH ATP [X-RAY DIFFRACTION]
Crystal structure of the autoinhibited form of mouse DAPK2 in complex with AMP [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000034944
AA Change: R271G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000034944
Gene: ENSMUSG00000032380
AA Change: R271G

DomainStartEndE-ValueType
S_TKc 23 285 6.26e-98 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132987
SMART Domains Protein: ENSMUSP00000117134
Gene: ENSMUSG00000032380

DomainStartEndE-ValueType
Pfam:Pkinase 1 52 2e-14 PFAM
Pfam:Pkinase_Tyr 1 53 1.7e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.0%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the serine/threonine protein kinase family. This protein contains a N-terminal protein kinase domain followed by a conserved calmodulin-binding domain with significant similarity to that of death-associated protein kinase 1 (DAPK1), a positive regulator of programmed cell death. Overexpression of this gene was shown to induce cell apoptosis. It uses multiple polyadenylation sites. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI314180 A G 4: 58,853,114 probably null Het
Ankrd34a A G 3: 96,598,422 N314S possibly damaging Het
Arhgef3 A T 14: 27,144,018 probably benign Het
Bmp1 T C 14: 70,508,858 R114G probably benign Het
Cenpf A G 1: 189,653,792 L2097P probably damaging Het
Dnase2a A T 8: 84,909,625 N130I possibly damaging Het
Dpp10 C T 1: 123,341,650 V677M possibly damaging Het
Dsp G A 13: 38,167,646 C147Y possibly damaging Het
Esyt2 A G 12: 116,324,130 T223A probably benign Het
Fndc5 G A 4: 129,138,780 V59I possibly damaging Het
Fsip2 A G 2: 82,981,949 T2871A possibly damaging Het
H2-Eb1 A T 17: 34,309,857 R121* probably null Het
Hydin A G 8: 110,398,125 I589V probably benign Het
Kitl A G 10: 100,051,852 I48V probably damaging Het
Large1 A G 8: 73,116,419 S159P probably damaging Het
Lrba T C 3: 86,745,873 L2570P probably benign Het
Mag G A 7: 30,911,433 T128I possibly damaging Het
Mb21d1 A G 9: 78,442,558 V174A probably damaging Het
Mkrn3 G T 7: 62,419,133 D303E possibly damaging Het
Myo9a A G 9: 59,894,768 D1951G probably damaging Het
Nup85 C T 11: 115,582,955 T565I possibly damaging Het
Olfr1077-ps1 T C 2: 86,525,649 H176R probably damaging Het
Olfr1156 T C 2: 87,949,979 I85V possibly damaging Het
Olfr902 A G 9: 38,448,938 D22G probably benign Het
Olfr915 A G 9: 38,646,874 S217P probably damaging Het
Pdzrn3 A T 6: 101,154,192 probably null Het
Picalm T A 7: 90,191,375 N434K probably damaging Het
Platr25 A C 13: 62,705,748 D77E probably benign Het
Prr22 A T 17: 56,772,028 R394* probably null Het
Psg23 A T 7: 18,614,711 L57Q probably damaging Het
Rap1gap2 G A 11: 74,484,948 S44L possibly damaging Het
Rffl A G 11: 82,845,750 probably null Het
Stox2 G A 8: 47,203,132 T103I probably damaging Het
Swt1 T C 1: 151,397,268 N543S possibly damaging Het
Tep1 C T 14: 50,833,913 probably null Het
Tln2 A G 9: 67,258,485 Y1023H probably damaging Het
Tssk5 C A 15: 76,372,896 R262L possibly damaging Het
Ttn C T 2: 76,880,642 probably benign Het
Ubtfl1 A T 9: 18,409,577 I134F probably benign Het
Unc80 T C 1: 66,648,511 F2351S possibly damaging Het
Vps13a A T 19: 16,723,740 D688E probably benign Het
Other mutations in Dapk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Dapk2 APN 9 66268778 splice site probably benign
IGL01304:Dapk2 APN 9 66231857 splice site probably benign
IGL02053:Dapk2 APN 9 66220745 missense probably benign 0.02
IGL02351:Dapk2 APN 9 66246523 missense probably damaging 0.99
IGL02358:Dapk2 APN 9 66246523 missense probably damaging 0.99
IGL02736:Dapk2 APN 9 66268916 missense probably benign
IGL02742:Dapk2 APN 9 66231814 missense probably damaging 1.00
PIT4618001:Dapk2 UTSW 9 66268686 missense probably benign 0.01
R0367:Dapk2 UTSW 9 66268886 missense probably damaging 0.99
R1375:Dapk2 UTSW 9 66220643 missense probably damaging 0.97
R1376:Dapk2 UTSW 9 66220643 missense probably damaging 0.97
R1376:Dapk2 UTSW 9 66220643 missense probably damaging 0.97
R1752:Dapk2 UTSW 9 66220643 missense probably damaging 0.97
R1924:Dapk2 UTSW 9 66165360 missense probably benign 0.05
R1981:Dapk2 UTSW 9 66268898 missense probably benign 0.00
R3160:Dapk2 UTSW 9 66254611 missense probably damaging 0.99
R3161:Dapk2 UTSW 9 66254611 missense probably damaging 0.99
R3162:Dapk2 UTSW 9 66254611 missense probably damaging 0.99
R3162:Dapk2 UTSW 9 66254611 missense probably damaging 0.99
R5394:Dapk2 UTSW 9 66268718 missense probably benign 0.00
R6750:Dapk2 UTSW 9 66220752 missense probably damaging 1.00
R6952:Dapk2 UTSW 9 66254622 missense probably benign 0.01
R6953:Dapk2 UTSW 9 66254622 missense probably benign 0.01
R8304:Dapk2 UTSW 9 66231745 missense possibly damaging 0.55
Z1088:Dapk2 UTSW 9 66246477 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- AACTGGGTTAGACTGCACTG -3'
(R):5'- AGTGCATGCTCATGTAGACAG -3'

Sequencing Primer
(F):5'- CTGGGTTAGACTGCACTGAAAAATC -3'
(R):5'- GCTCATGTAGACAGAGACATTTG -3'
Posted On2018-11-28