Incidental Mutation 'R6951:Mb21d1'
ID541276
Institutional Source Beutler Lab
Gene Symbol Mb21d1
Ensembl Gene ENSMUSG00000032344
Gene NameMab-21 domain containing 1
SynonymsE330016A19Rik, cGas
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_173386; MGI:2442261

Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R6951 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location78430526-78443237 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78442558 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 174 (V174A)
Ref Sequence ENSEMBL: ENSMUSP00000034898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034898] [ENSMUST00000070742]
Predicted Effect probably damaging
Transcript: ENSMUST00000034898
AA Change: V174A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000034898
Gene: ENSMUSG00000032344
AA Change: V174A

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
low complexity region 148 163 N/A INTRINSIC
Mab-21 199 394 1.89e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000070742
AA Change: V174A

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000063331
Gene: ENSMUSG00000032344
AA Change: V174A

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
low complexity region 148 163 N/A INTRINSIC
Mab-21 199 498 2.79e-91 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000114277
Gene: ENSMUSG00000032344
AA Change: V109A

DomainStartEndE-ValueType
low complexity region 84 99 N/A INTRINSIC
Pfam:Mab-21 136 229 6.8e-16 PFAM
Meta Mutation Damage Score 0.4940 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.0%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: The protein encoded by this gene is a DNA binding cytosolic protein that catalyzes the synthesis of cyclic guanosine monophosphate-adenosine monophosphate (cGAMP) after sensing the presence of DNA in the cytoplasm. cGAMP binds another protein, Stimulator of interferon genes (STING), leading to the induction of interferons, and a host immune response. Reduced expression of this gene inhibits interferon induction in the presence of some viral infections. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit increased susceptibility to viral infection and abnormal innate immunity. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(2) Gene trapped(4)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI314180 A G 4: 58,853,114 probably null Het
Ankrd34a A G 3: 96,598,422 N314S possibly damaging Het
Arhgef3 A T 14: 27,144,018 probably benign Het
Bmp1 T C 14: 70,508,858 R114G probably benign Het
Cenpf A G 1: 189,653,792 L2097P probably damaging Het
Dapk2 C G 9: 66,254,622 R271G probably benign Het
Dnase2a A T 8: 84,909,625 N130I possibly damaging Het
Dpp10 C T 1: 123,341,650 V677M possibly damaging Het
Dsp G A 13: 38,167,646 C147Y possibly damaging Het
Esyt2 A G 12: 116,324,130 T223A probably benign Het
Fndc5 G A 4: 129,138,780 V59I possibly damaging Het
Fsip2 A G 2: 82,981,949 T2871A possibly damaging Het
H2-Eb1 A T 17: 34,309,857 R121* probably null Het
Hydin A G 8: 110,398,125 I589V probably benign Het
Kitl A G 10: 100,051,852 I48V probably damaging Het
Large1 A G 8: 73,116,419 S159P probably damaging Het
Lrba T C 3: 86,745,873 L2570P probably benign Het
Mag G A 7: 30,911,433 T128I possibly damaging Het
Mkrn3 G T 7: 62,419,133 D303E possibly damaging Het
Myo9a A G 9: 59,894,768 D1951G probably damaging Het
Nup85 C T 11: 115,582,955 T565I possibly damaging Het
Olfr1077-ps1 T C 2: 86,525,649 H176R probably damaging Het
Olfr1156 T C 2: 87,949,979 I85V possibly damaging Het
Olfr902 A G 9: 38,448,938 D22G probably benign Het
Olfr915 A G 9: 38,646,874 S217P probably damaging Het
Pdzrn3 A T 6: 101,154,192 probably null Het
Picalm T A 7: 90,191,375 N434K probably damaging Het
Platr25 A C 13: 62,705,748 D77E probably benign Het
Prr22 A T 17: 56,772,028 R394* probably null Het
Psg23 A T 7: 18,614,711 L57Q probably damaging Het
Rap1gap2 G A 11: 74,484,948 S44L possibly damaging Het
Rffl A G 11: 82,845,750 probably null Het
Stox2 G A 8: 47,203,132 T103I probably damaging Het
Swt1 T C 1: 151,397,268 N543S possibly damaging Het
Tep1 C T 14: 50,833,913 probably null Het
Tln2 A G 9: 67,258,485 Y1023H probably damaging Het
Tssk5 C A 15: 76,372,896 R262L possibly damaging Het
Ttn C T 2: 76,880,642 probably benign Het
Ubtfl1 A T 9: 18,409,577 I134F probably benign Het
Unc80 T C 1: 66,648,511 F2351S possibly damaging Het
Vps13a A T 19: 16,723,740 D688E probably benign Het
Other mutations in Mb21d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Mb21d1 APN 9 78435587 missense probably damaging 1.00
IGL00727:Mb21d1 APN 9 78435488 missense probably damaging 0.99
IGL00730:Mb21d1 APN 9 78435488 missense probably damaging 0.99
IGL00731:Mb21d1 APN 9 78435488 missense probably damaging 0.99
IGL00737:Mb21d1 APN 9 78435488 missense probably damaging 0.99
IGL00753:Mb21d1 APN 9 78435488 missense probably damaging 0.99
IGL00754:Mb21d1 APN 9 78435488 missense probably damaging 0.99
IGL00832:Mb21d1 APN 9 78434317 missense probably damaging 1.00
IGL00848:Mb21d1 APN 9 78435488 missense probably damaging 0.99
IGL00849:Mb21d1 APN 9 78435488 missense probably damaging 0.99
IGL01627:Mb21d1 APN 9 78442714 missense possibly damaging 0.70
IGL01642:Mb21d1 APN 9 78437398 missense probably damaging 1.00
IGL01993:Mb21d1 APN 9 78442520 missense probably benign 0.18
IGL02206:Mb21d1 APN 9 78443080 unclassified probably null
IGL02367:Mb21d1 APN 9 78434385 missense probably benign 0.04
IGL03053:Mb21d1 APN 9 78437437 missense probably benign 0.14
R0361:Mb21d1 UTSW 9 78433252 missense probably damaging 1.00
R0426:Mb21d1 UTSW 9 78435738 splice site probably benign
R1531:Mb21d1 UTSW 9 78442481 missense probably damaging 1.00
R1554:Mb21d1 UTSW 9 78435556 missense probably damaging 1.00
R1817:Mb21d1 UTSW 9 78434311 critical splice donor site probably null
R1872:Mb21d1 UTSW 9 78433202 missense probably benign 0.06
R1964:Mb21d1 UTSW 9 78437455 missense probably damaging 0.99
R4162:Mb21d1 UTSW 9 78434404 missense probably damaging 1.00
R7199:Mb21d1 UTSW 9 78433033 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- AAGACTGGGGTGTTCCAAGG -3'
(R):5'- TGAGCTCACCAAAGATGCAC -3'

Sequencing Primer
(F):5'- GGGCCCTAAGAGTGTGGGAC -3'
(R):5'- AAGATGCACAGCCCTCGG -3'
Posted On2018-11-28