Incidental Mutation 'R6951:Kitl'
ID 541277
Institutional Source Beutler Lab
Gene Symbol Kitl
Ensembl Gene ENSMUSG00000019966
Gene Name kit ligand
Synonyms blz, Mgf, SLF, SF, Kitlg, Steel factor, stem cell factor, Steel, Sl, SCF, Gb, grizzle-belly
MMRRC Submission 045063-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.205) question?
Stock # R6951 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 99851492-99936278 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 99887714 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 48 (I48V)
Ref Sequence ENSEMBL: ENSMUSP00000123360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020129] [ENSMUST00000105283] [ENSMUST00000130190] [ENSMUST00000218200]
AlphaFold P20826
Predicted Effect probably damaging
Transcript: ENSMUST00000020129
AA Change: I8V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000020129
Gene: ENSMUSG00000019966
AA Change: I8V

DomainStartEndE-ValueType
Pfam:SCF 1 176 5.7e-102 PFAM
Pfam:SCF 173 245 1.7e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105283
AA Change: I8V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000100920
Gene: ENSMUSG00000019966
AA Change: I8V

DomainStartEndE-ValueType
Pfam:SCF 1 273 2.3e-157 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000130190
AA Change: I48V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000123360
Gene: ENSMUSG00000019966
AA Change: I48V

DomainStartEndE-ValueType
Pfam:SCF 43 160 1.1e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218200
Meta Mutation Damage Score 0.2009 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.0%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the ligand of the tyrosine-kinase receptor encoded by the KIT locus. This ligand is a pleiotropic factor that acts in utero in germ cell and neural cell development, and hematopoiesis, all believed to reflect a role in cell migration. In adults, it functions pleiotropically, while mostly noted for its continued requirement in hematopoiesis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene affect migration of embryonic stem cells and cause similar phenotypes to mutations in its receptor gene (Kit). Mutants show mild to severe defects in pigmentation, hemopoiesis and reproduction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd34a A G 3: 96,505,738 (GRCm39) N314S possibly damaging Het
Arhgef3 A T 14: 26,865,975 (GRCm39) probably benign Het
Bmp1 T C 14: 70,746,298 (GRCm39) R114G probably benign Het
Cenpf A G 1: 189,385,989 (GRCm39) L2097P probably damaging Het
Cgas A G 9: 78,349,840 (GRCm39) V174A probably damaging Het
Dapk2 C G 9: 66,161,904 (GRCm39) R271G probably benign Het
Dnase2a A T 8: 85,636,254 (GRCm39) N130I possibly damaging Het
Dpp10 C T 1: 123,269,379 (GRCm39) V677M possibly damaging Het
Dsp G A 13: 38,351,622 (GRCm39) C147Y possibly damaging Het
Ecpas A G 4: 58,853,114 (GRCm39) probably null Het
Esyt2 A G 12: 116,287,750 (GRCm39) T223A probably benign Het
Fndc5 G A 4: 129,032,573 (GRCm39) V59I possibly damaging Het
Fsip2 A G 2: 82,812,293 (GRCm39) T2871A possibly damaging Het
H2-Eb1 A T 17: 34,528,831 (GRCm39) R121* probably null Het
Hydin A G 8: 111,124,757 (GRCm39) I589V probably benign Het
Large1 A G 8: 73,843,047 (GRCm39) S159P probably damaging Het
Lrba T C 3: 86,653,180 (GRCm39) L2570P probably benign Het
Mag G A 7: 30,610,858 (GRCm39) T128I possibly damaging Het
Mkrn3 G T 7: 62,068,881 (GRCm39) D303E possibly damaging Het
Myo9a A G 9: 59,802,051 (GRCm39) D1951G probably damaging Het
Nup85 C T 11: 115,473,781 (GRCm39) T565I possibly damaging Het
Or5l13 T C 2: 87,780,323 (GRCm39) I85V possibly damaging Het
Or8b1d A G 9: 38,558,170 (GRCm39) S217P probably damaging Het
Or8b43 A G 9: 38,360,234 (GRCm39) D22G probably benign Het
Or8k31-ps1 T C 2: 86,355,993 (GRCm39) H176R probably damaging Het
Pdzrn3 A T 6: 101,131,153 (GRCm39) probably null Het
Picalm T A 7: 89,840,583 (GRCm39) N434K probably damaging Het
Platr25 A C 13: 62,853,562 (GRCm39) D77E probably benign Het
Prr22 A T 17: 57,079,028 (GRCm39) R394* probably null Het
Psg23 A T 7: 18,348,636 (GRCm39) L57Q probably damaging Het
Rap1gap2 G A 11: 74,375,774 (GRCm39) S44L possibly damaging Het
Rffl A G 11: 82,736,576 (GRCm39) probably null Het
Stox2 G A 8: 47,656,167 (GRCm39) T103I probably damaging Het
Swt1 T C 1: 151,273,019 (GRCm39) N543S possibly damaging Het
Tep1 C T 14: 51,071,370 (GRCm39) probably null Het
Tln2 A G 9: 67,165,767 (GRCm39) Y1023H probably damaging Het
Tssk5 C A 15: 76,257,096 (GRCm39) R262L possibly damaging Het
Ttn C T 2: 76,710,986 (GRCm39) probably benign Het
Ubtfl1 A T 9: 18,320,873 (GRCm39) I134F probably benign Het
Unc80 T C 1: 66,687,670 (GRCm39) F2351S possibly damaging Het
Vps13a A T 19: 16,701,104 (GRCm39) D688E probably benign Het
Other mutations in Kitl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Kitl APN 10 99,923,206 (GRCm39) splice site probably benign
IGL02066:Kitl APN 10 99,912,744 (GRCm39) missense probably damaging 1.00
IGL03211:Kitl APN 10 99,916,721 (GRCm39) missense probably benign 0.19
Gregory UTSW 10 99,912,768 (GRCm39) critical splice donor site probably null
mooyah UTSW 10 99,924,084 (GRCm39) critical splice donor site probably null
Sandycheeks UTSW 10 99,912,768 (GRCm39) critical splice donor site probably null
R0131:Kitl UTSW 10 99,923,226 (GRCm39) missense probably benign 0.11
R0131:Kitl UTSW 10 99,923,226 (GRCm39) missense probably benign 0.11
R0132:Kitl UTSW 10 99,923,226 (GRCm39) missense probably benign 0.11
R1554:Kitl UTSW 10 99,923,300 (GRCm39) missense probably benign 0.38
R1649:Kitl UTSW 10 99,899,976 (GRCm39) missense probably benign 0.03
R2194:Kitl UTSW 10 99,851,899 (GRCm39) critical splice donor site probably null
R2254:Kitl UTSW 10 99,915,993 (GRCm39) critical splice donor site probably null
R4877:Kitl UTSW 10 99,916,728 (GRCm39) missense probably damaging 1.00
R5135:Kitl UTSW 10 99,924,084 (GRCm39) critical splice donor site probably null
R5453:Kitl UTSW 10 99,923,247 (GRCm39) missense probably damaging 1.00
R5564:Kitl UTSW 10 99,915,886 (GRCm39) missense possibly damaging 0.89
R5832:Kitl UTSW 10 99,915,882 (GRCm39) missense probably damaging 1.00
R5971:Kitl UTSW 10 99,912,768 (GRCm39) critical splice donor site probably null
R6043:Kitl UTSW 10 99,899,947 (GRCm39) missense probably damaging 1.00
R6067:Kitl UTSW 10 99,912,768 (GRCm39) critical splice donor site probably null
R6138:Kitl UTSW 10 99,912,768 (GRCm39) critical splice donor site probably null
R6255:Kitl UTSW 10 99,925,095 (GRCm39) makesense probably null
R6450:Kitl UTSW 10 99,923,256 (GRCm39) start codon destroyed probably null 0.00
R6588:Kitl UTSW 10 99,899,954 (GRCm39) missense probably damaging 1.00
R7315:Kitl UTSW 10 99,851,974 (GRCm39) missense unknown
R7368:Kitl UTSW 10 99,851,943 (GRCm39) missense probably benign 0.02
R8010:Kitl UTSW 10 99,887,765 (GRCm39) missense probably benign 0.22
R8234:Kitl UTSW 10 99,887,708 (GRCm39) missense probably damaging 1.00
R9613:Kitl UTSW 10 99,916,781 (GRCm39) missense probably damaging 1.00
U15987:Kitl UTSW 10 99,912,768 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCTCATTTCAGTTTGGCGAGAG -3'
(R):5'- GGAGTGCCCTAAATCTATGTGG -3'

Sequencing Primer
(F):5'- ccGCAGCTCTGGTATATTT -3'
(R):5'- GCCCTAAATCTATGTGGTCAGCAAG -3'
Posted On 2018-11-28