Incidental Mutation 'R6951:Rap1gap2'
ID541278
Institutional Source Beutler Lab
Gene Symbol Rap1gap2
Ensembl Gene ENSMUSG00000038807
Gene NameRAP1 GTPase activating protein 2
SynonymsGarnl4, LOC380710
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.635) question?
Stock #R6951 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location74383356-74610915 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 74484948 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 44 (S44L)
Ref Sequence ENSEMBL: ENSMUSP00000146728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047488] [ENSMUST00000102521] [ENSMUST00000145524] [ENSMUST00000208896]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047488
AA Change: S76L

PolyPhen 2 Score 0.463 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000040180
Gene: ENSMUSG00000038807
AA Change: S76L

DomainStartEndE-ValueType
Pfam:Rap_GAP 258 445 1.2e-64 PFAM
low complexity region 617 629 N/A INTRINSIC
low complexity region 660 669 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102521
AA Change: S16L

PolyPhen 2 Score 0.290 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099580
Gene: ENSMUSG00000038807
AA Change: S16L

DomainStartEndE-ValueType
Pfam:Rap_GAP 258 439 4.9e-67 PFAM
low complexity region 617 629 N/A INTRINSIC
low complexity region 660 669 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145524
AA Change: S16L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect possibly damaging
Transcript: ENSMUST00000208896
AA Change: S44L

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.0617 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.0%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTPase-activating protein that activates the small guanine-nucleotide-binding protein Rap1 in platelets. The protein interacts with synaptotagmin-like protein 1 and Rab27 and regulates secretion of dense granules from platelets at sites of endothelial damage. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit normal blood lymphocyte populations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI314180 A G 4: 58,853,114 probably null Het
Ankrd34a A G 3: 96,598,422 N314S possibly damaging Het
Arhgef3 A T 14: 27,144,018 probably benign Het
Bmp1 T C 14: 70,508,858 R114G probably benign Het
Cenpf A G 1: 189,653,792 L2097P probably damaging Het
Dapk2 C G 9: 66,254,622 R271G probably benign Het
Dnase2a A T 8: 84,909,625 N130I possibly damaging Het
Dpp10 C T 1: 123,341,650 V677M possibly damaging Het
Dsp G A 13: 38,167,646 C147Y possibly damaging Het
Esyt2 A G 12: 116,324,130 T223A probably benign Het
Fndc5 G A 4: 129,138,780 V59I possibly damaging Het
Fsip2 A G 2: 82,981,949 T2871A possibly damaging Het
H2-Eb1 A T 17: 34,309,857 R121* probably null Het
Hydin A G 8: 110,398,125 I589V probably benign Het
Kitl A G 10: 100,051,852 I48V probably damaging Het
Large1 A G 8: 73,116,419 S159P probably damaging Het
Lrba T C 3: 86,745,873 L2570P probably benign Het
Mag G A 7: 30,911,433 T128I possibly damaging Het
Mb21d1 A G 9: 78,442,558 V174A probably damaging Het
Mkrn3 G T 7: 62,419,133 D303E possibly damaging Het
Myo9a A G 9: 59,894,768 D1951G probably damaging Het
Nup85 C T 11: 115,582,955 T565I possibly damaging Het
Olfr1077-ps1 T C 2: 86,525,649 H176R probably damaging Het
Olfr1156 T C 2: 87,949,979 I85V possibly damaging Het
Olfr902 A G 9: 38,448,938 D22G probably benign Het
Olfr915 A G 9: 38,646,874 S217P probably damaging Het
Pdzrn3 A T 6: 101,154,192 probably null Het
Picalm T A 7: 90,191,375 N434K probably damaging Het
Platr25 A C 13: 62,705,748 D77E probably benign Het
Prr22 A T 17: 56,772,028 R394* probably null Het
Psg23 A T 7: 18,614,711 L57Q probably damaging Het
Rffl A G 11: 82,845,750 probably null Het
Stox2 G A 8: 47,203,132 T103I probably damaging Het
Swt1 T C 1: 151,397,268 N543S possibly damaging Het
Tep1 C T 14: 50,833,913 probably null Het
Tln2 A G 9: 67,258,485 Y1023H probably damaging Het
Tssk5 C A 15: 76,372,896 R262L possibly damaging Het
Ttn C T 2: 76,880,642 probably benign Het
Ubtfl1 A T 9: 18,409,577 I134F probably benign Het
Unc80 T C 1: 66,648,511 F2351S possibly damaging Het
Vps13a A T 19: 16,723,740 D688E probably benign Het
Other mutations in Rap1gap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00687:Rap1gap2 APN 11 74416259 missense probably benign 0.25
IGL00839:Rap1gap2 APN 11 74437448 missense probably damaging 1.00
IGL02301:Rap1gap2 APN 11 74407369 missense probably damaging 1.00
IGL02367:Rap1gap2 APN 11 74397355 critical splice donor site probably null
IGL02832:Rap1gap2 APN 11 74412455 splice site probably benign
IGL03067:Rap1gap2 APN 11 74393412 missense possibly damaging 0.63
IGL03341:Rap1gap2 APN 11 74435714 missense probably damaging 1.00
IGL03355:Rap1gap2 APN 11 74412344 missense probably damaging 1.00
P0026:Rap1gap2 UTSW 11 74567210 splice site probably benign
R0106:Rap1gap2 UTSW 11 74435744 missense probably benign 0.10
R0106:Rap1gap2 UTSW 11 74435744 missense probably benign 0.10
R0514:Rap1gap2 UTSW 11 74388854 missense possibly damaging 0.74
R0518:Rap1gap2 UTSW 11 74441766 missense probably damaging 1.00
R0521:Rap1gap2 UTSW 11 74441766 missense probably damaging 1.00
R1070:Rap1gap2 UTSW 11 74437027 missense possibly damaging 0.71
R1467:Rap1gap2 UTSW 11 74437027 missense possibly damaging 0.71
R1467:Rap1gap2 UTSW 11 74437027 missense possibly damaging 0.71
R1998:Rap1gap2 UTSW 11 74395833 missense probably benign 0.04
R2144:Rap1gap2 UTSW 11 74425976 missense probably damaging 1.00
R2145:Rap1gap2 UTSW 11 74425976 missense probably damaging 1.00
R2180:Rap1gap2 UTSW 11 74393146 missense probably benign 0.24
R2938:Rap1gap2 UTSW 11 74407322 missense possibly damaging 0.71
R2991:Rap1gap2 UTSW 11 74407322 missense possibly damaging 0.71
R2992:Rap1gap2 UTSW 11 74407322 missense possibly damaging 0.71
R2993:Rap1gap2 UTSW 11 74407322 missense possibly damaging 0.71
R3033:Rap1gap2 UTSW 11 74407322 missense possibly damaging 0.71
R3035:Rap1gap2 UTSW 11 74407322 missense possibly damaging 0.71
R3686:Rap1gap2 UTSW 11 74407322 missense possibly damaging 0.71
R4426:Rap1gap2 UTSW 11 74407322 missense possibly damaging 0.71
R4427:Rap1gap2 UTSW 11 74407322 missense possibly damaging 0.71
R4621:Rap1gap2 UTSW 11 74435699 critical splice donor site probably null
R4705:Rap1gap2 UTSW 11 74437439 missense probably damaging 1.00
R4809:Rap1gap2 UTSW 11 74407974 splice site probably benign
R5092:Rap1gap2 UTSW 11 74438295 missense probably damaging 1.00
R5283:Rap1gap2 UTSW 11 74395825 missense probably damaging 1.00
R5343:Rap1gap2 UTSW 11 74441785 missense probably damaging 0.99
R5941:Rap1gap2 UTSW 11 74392237 missense probably damaging 1.00
R6414:Rap1gap2 UTSW 11 74405790 missense probably damaging 1.00
R6647:Rap1gap2 UTSW 11 74407928 missense probably benign 0.04
R7096:Rap1gap2 UTSW 11 74392231 missense probably damaging 0.99
R7107:Rap1gap2 UTSW 11 74393119 missense probably damaging 1.00
R7397:Rap1gap2 UTSW 11 74414411 missense probably benign 0.28
R7553:Rap1gap2 UTSW 11 74435722 missense probably damaging 0.97
R8038:Rap1gap2 UTSW 11 74392283 missense probably benign 0.00
R8051:Rap1gap2 UTSW 11 74395825 missense probably damaging 0.97
Z1176:Rap1gap2 UTSW 11 74610877 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGGCCTCAGTCATACTTCCC -3'
(R):5'- GCGCTGTACTGCTTTCACTG -3'

Sequencing Primer
(F):5'- ACACTGACTCCTGAAGTGTTG -3'
(R):5'- GTACTGCTTTCACTGTTAGTATATCC -3'
Posted On2018-11-28