Incidental Mutation 'R6951:Rffl'
ID541279
Institutional Source Beutler Lab
Gene Symbol Rffl
Ensembl Gene ENSMUSG00000020696
Gene Namering finger and FYVE like domain containing protein
Synonyms1700051E09Rik, Carp-2, 4930516L10Rik, rififylin, fring, Carp2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6951 (G1)
Quality Score190.009
Status Validated
Chromosome11
Chromosomal Location82802449-82871210 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 82845750 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071152] [ENSMUST00000093975] [ENSMUST00000108173] [ENSMUST00000126660]
Predicted Effect probably null
Transcript: ENSMUST00000071152
SMART Domains Protein: ENSMUSP00000071150
Gene: ENSMUSG00000020696

DomainStartEndE-ValueType
PDB:1Y02|A 62 180 1e-74 PDB
Blast:RING 82 123 2e-19 BLAST
low complexity region 198 210 N/A INTRINSIC
RING 351 385 3.47e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093975
SMART Domains Protein: ENSMUSP00000091510
Gene: ENSMUSG00000020696

DomainStartEndE-ValueType
PDB:1Y02|A 41 159 6e-75 PDB
Blast:RING 61 102 2e-19 BLAST
low complexity region 177 189 N/A INTRINSIC
RING 330 364 3.47e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108173
SMART Domains Protein: ENSMUSP00000103808
Gene: ENSMUSG00000020696

DomainStartEndE-ValueType
PDB:1Y02|A 27 145 4e-75 PDB
Blast:RING 47 88 2e-19 BLAST
low complexity region 163 175 N/A INTRINSIC
RING 316 350 3.47e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000126660
SMART Domains Protein: ENSMUSP00000115846
Gene: ENSMUSG00000020696

DomainStartEndE-ValueType
PDB:1Y02|A 62 142 9e-50 PDB
SCOP:d1vfya_ 81 121 1e-3 SMART
Blast:RING 82 123 7e-21 BLAST
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.0%
Validation Efficiency 100% (42/42)
MGI Phenotype PHENOTYPE: Mice homozygous for an inactivating targeted mutation of this gene are born at the expected Mendelian frequency; they are viable and fertile and exhibit no apparent abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI314180 A G 4: 58,853,114 probably null Het
Ankrd34a A G 3: 96,598,422 N314S possibly damaging Het
Arhgef3 A T 14: 27,144,018 probably benign Het
Bmp1 T C 14: 70,508,858 R114G probably benign Het
Cenpf A G 1: 189,653,792 L2097P probably damaging Het
Dapk2 C G 9: 66,254,622 R271G probably benign Het
Dnase2a A T 8: 84,909,625 N130I possibly damaging Het
Dpp10 C T 1: 123,341,650 V677M possibly damaging Het
Dsp G A 13: 38,167,646 C147Y possibly damaging Het
Esyt2 A G 12: 116,324,130 T223A probably benign Het
Fndc5 G A 4: 129,138,780 V59I possibly damaging Het
Fsip2 A G 2: 82,981,949 T2871A possibly damaging Het
H2-Eb1 A T 17: 34,309,857 R121* probably null Het
Hydin A G 8: 110,398,125 I589V probably benign Het
Kitl A G 10: 100,051,852 I48V probably damaging Het
Large1 A G 8: 73,116,419 S159P probably damaging Het
Lrba T C 3: 86,745,873 L2570P probably benign Het
Mag G A 7: 30,911,433 T128I possibly damaging Het
Mb21d1 A G 9: 78,442,558 V174A probably damaging Het
Mkrn3 G T 7: 62,419,133 D303E possibly damaging Het
Myo9a A G 9: 59,894,768 D1951G probably damaging Het
Nup85 C T 11: 115,582,955 T565I possibly damaging Het
Olfr1077-ps1 T C 2: 86,525,649 H176R probably damaging Het
Olfr1156 T C 2: 87,949,979 I85V possibly damaging Het
Olfr902 A G 9: 38,448,938 D22G probably benign Het
Olfr915 A G 9: 38,646,874 S217P probably damaging Het
Pdzrn3 A T 6: 101,154,192 probably null Het
Picalm T A 7: 90,191,375 N434K probably damaging Het
Platr25 A C 13: 62,705,748 D77E probably benign Het
Prr22 A T 17: 56,772,028 R394* probably null Het
Psg23 A T 7: 18,614,711 L57Q probably damaging Het
Rap1gap2 G A 11: 74,484,948 S44L possibly damaging Het
Stox2 G A 8: 47,203,132 T103I probably damaging Het
Swt1 T C 1: 151,397,268 N543S possibly damaging Het
Tep1 C T 14: 50,833,913 probably null Het
Tln2 A G 9: 67,258,485 Y1023H probably damaging Het
Tssk5 C A 15: 76,372,896 R262L possibly damaging Het
Ttn C T 2: 76,880,642 probably benign Het
Ubtfl1 A T 9: 18,409,577 I134F probably benign Het
Unc80 T C 1: 66,648,511 F2351S possibly damaging Het
Vps13a A T 19: 16,723,740 D688E probably benign Het
Other mutations in Rffl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Rffl APN 11 82818484 missense probably damaging 1.00
IGL01120:Rffl APN 11 82806022 missense probably damaging 1.00
IGL01295:Rffl APN 11 82818457 missense probably damaging 1.00
IGL01635:Rffl APN 11 82812552 missense probably benign 0.00
R0127:Rffl UTSW 11 82812632 missense probably damaging 1.00
R0195:Rffl UTSW 11 82810163 missense probably damaging 1.00
R2125:Rffl UTSW 11 82818438 missense probably damaging 0.99
R5030:Rffl UTSW 11 82812717 nonsense probably null
R5104:Rffl UTSW 11 82812793 nonsense probably null
R5283:Rffl UTSW 11 82812789 missense probably damaging 1.00
R5483:Rffl UTSW 11 82812723 synonymous probably null
R5828:Rffl UTSW 11 82818418 missense probably damaging 1.00
R5974:Rffl UTSW 11 82806151 missense probably damaging 1.00
R6651:Rffl UTSW 11 82812779 missense probably damaging 1.00
R7053:Rffl UTSW 11 82812671 missense probably null 1.00
R7587:Rffl UTSW 11 82810148 missense probably damaging 1.00
R7782:Rffl UTSW 11 82812769 nonsense probably null
R8192:Rffl UTSW 11 82812723 synonymous probably null
R8243:Rffl UTSW 11 82812795 missense probably damaging 1.00
RF009:Rffl UTSW 11 82845772 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTTGAGCGAACTGTTTCTCG -3'
(R):5'- TGAGCTCTGTTGCAACGTTG -3'

Sequencing Primer
(F):5'- GAGCGAACTGTTTCTCGTAAGACAC -3'
(R):5'- GATCTCATCCGAACATGG -3'
Posted On2018-11-28