Incidental Mutation 'R0606:Cst7'
ID 54128
Institutional Source Beutler Lab
Gene Symbol Cst7
Ensembl Gene ENSMUSG00000068129
Gene Name cystatin F (leukocystatin)
Synonyms Leukocystatin, cystatin-like metastasis-associated protein, CMAP
MMRRC Submission 038795-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0606 (G1)
Quality Score 138
Status Validated
Chromosome 2
Chromosomal Location 150412335-150420864 bp(+) (GRCm39)
Type of Mutation start codon destroyed
DNA Base Change (assembly) A to T at 150412439 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 1 (M1L)
Ref Sequence ENSEMBL: ENSMUSP00000086606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089200]
AlphaFold O89098
Predicted Effect probably benign
Transcript: ENSMUST00000089200
AA Change: M1L

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000086606
Gene: ENSMUSG00000068129
AA Change: M1L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CY 33 144 1.04e-22 SMART
Meta Mutation Damage Score 0.5910 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.2%
Validation Efficiency 98% (99/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions. This gene encodes a glycosylated cysteine protease inhibitor with a putative role in immune regulation through inhibition of a unique target in the hematopoietic system. Expression of the protein has been observed in various human cancer cell lines established from malignant tumors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl9 T C 17: 33,652,572 (GRCm39) Y211H probably damaging Het
Actn1 A T 12: 80,221,421 (GRCm39) probably benign Het
Adtrp A G 13: 41,920,881 (GRCm39) F197L probably damaging Het
Ankrd11 G A 8: 123,619,571 (GRCm39) T1406I probably benign Het
Arhgap24 A T 5: 103,045,086 (GRCm39) R620W probably damaging Het
Atg13 A G 2: 91,512,418 (GRCm39) Y284H probably benign Het
Atrn A G 2: 130,748,776 (GRCm39) E99G possibly damaging Het
Cage1 A T 13: 38,200,470 (GRCm39) probably benign Het
Cblif A T 19: 11,729,658 (GRCm39) I206F possibly damaging Het
Ccr3 T A 9: 123,828,839 (GRCm39) M58K probably benign Het
Cdk18 G T 1: 132,045,355 (GRCm39) probably benign Het
Chst5 A G 8: 112,617,551 (GRCm39) V23A probably benign Het
Col4a3 T C 1: 82,650,307 (GRCm39) probably benign Het
Col4a6 A G X: 139,975,219 (GRCm39) probably benign Het
Csmd3 T C 15: 48,321,058 (GRCm39) I251V probably benign Het
Csnk1g3 G A 18: 54,050,100 (GRCm39) V115M probably damaging Het
Cyp4f17 A T 17: 32,746,817 (GRCm39) D373V probably damaging Het
Dclk2 G A 3: 86,813,311 (GRCm39) R212W probably damaging Het
Dhrs7b T G 11: 60,721,572 (GRCm39) probably benign Het
Dhx58 T A 11: 100,593,077 (GRCm39) H210L probably benign Het
Dnah9 T C 11: 65,732,159 (GRCm39) Y4249C probably damaging Het
Eif5b T A 1: 38,087,974 (GRCm39) L990H probably damaging Het
Faap24 T C 7: 35,094,388 (GRCm39) probably benign Het
Fryl T A 5: 73,282,077 (GRCm39) H174L probably benign Het
Gabrr1 T C 4: 33,132,696 (GRCm39) W15R probably benign Het
Gm15446 T C 5: 110,091,347 (GRCm39) V533A probably benign Het
Gm6760 T A X: 63,195,259 (GRCm39) K63* probably null Het
Gne C T 4: 44,042,244 (GRCm39) E444K possibly damaging Het
Gpr173 T A X: 151,130,036 (GRCm39) M146L possibly damaging Het
Hira C T 16: 18,753,797 (GRCm39) S547L probably benign Het
Hnf1b A G 11: 83,754,810 (GRCm39) H161R probably benign Het
Hnrnpm T A 17: 33,877,364 (GRCm39) N53I probably damaging Het
Hs3st5 A T 10: 36,708,584 (GRCm39) I40F probably benign Het
Hydin C T 8: 111,276,430 (GRCm39) probably benign Het
Ift172 A G 5: 31,411,657 (GRCm39) I1607T probably damaging Het
Igfn1 T C 1: 135,887,639 (GRCm39) Q2475R probably damaging Het
Il6st T C 13: 112,640,806 (GRCm39) S800P possibly damaging Het
Iqub G A 6: 24,501,260 (GRCm39) probably benign Het
Itgb1 A T 8: 129,448,853 (GRCm39) probably benign Het
Kctd21 G A 7: 96,996,808 (GRCm39) E94K probably benign Het
Kir3dl2 A G X: 135,354,260 (GRCm39) V233A possibly damaging Het
Klra2 A T 6: 131,197,187 (GRCm39) C271S probably damaging Het
Lacc1 A T 14: 77,267,061 (GRCm39) C401S probably damaging Het
Lmna T C 3: 88,389,885 (GRCm39) E580G probably damaging Het
Matn2 A G 15: 34,345,296 (GRCm39) Y101C probably damaging Het
Mrps16 G A 14: 20,441,457 (GRCm39) R116* probably null Het
Ndrg2 G T 14: 52,143,674 (GRCm39) R333S probably damaging Het
Nf2 A G 11: 4,732,194 (GRCm39) I507T possibly damaging Het
Nktr A G 9: 121,578,356 (GRCm39) probably benign Het
Nkx3-1 G A 14: 69,428,455 (GRCm39) probably benign Het
Npat T C 9: 53,467,781 (GRCm39) probably null Het
Nrxn1 T C 17: 90,872,801 (GRCm39) N1047S probably damaging Het
Nup210 A T 6: 91,003,911 (GRCm39) I1402N possibly damaging Het
Or5d40 G T 2: 88,015,624 (GRCm39) M134I possibly damaging Het
Parp14 G A 16: 35,677,130 (GRCm39) A946V probably benign Het
Pdcl2 C T 5: 76,460,328 (GRCm39) S182N probably benign Het
Pdia3 G A 2: 121,262,858 (GRCm39) G275S probably damaging Het
Pla2g4a A G 1: 149,716,455 (GRCm39) F669L probably benign Het
Plekha8 A G 6: 54,606,805 (GRCm39) K367E probably damaging Het
Pola1 A G X: 92,531,693 (GRCm39) probably benign Het
Ppm1d C T 11: 85,236,703 (GRCm39) T494I probably benign Het
Pramel16 T A 4: 143,676,453 (GRCm39) Y217F probably benign Het
Prl6a1 A T 13: 27,498,177 (GRCm39) probably benign Het
Ptprg T A 14: 12,154,131 (GRCm38) S617R probably benign Het
R3hdm2 G A 10: 127,280,313 (GRCm39) G45D probably damaging Het
Rev1 T A 1: 38,098,204 (GRCm39) R780W probably null Het
Rnf139 T A 15: 58,771,676 (GRCm39) F567Y probably damaging Het
Scarf1 T C 11: 75,405,174 (GRCm39) V71A probably damaging Het
Shtn1 A G 19: 58,988,372 (GRCm39) S438P probably damaging Het
Slc30a3 T A 5: 31,246,067 (GRCm39) H221L probably benign Het
Smo A C 6: 29,753,603 (GRCm39) I160L possibly damaging Het
Snapc5 A T 9: 64,086,582 (GRCm39) probably benign Het
Snf8 G T 11: 95,925,799 (GRCm39) probably benign Het
Spata31d1a T C 13: 59,850,245 (GRCm39) S628G probably benign Het
Sphkap A T 1: 83,258,145 (GRCm39) D199E probably damaging Het
Spring1 T C 5: 118,397,154 (GRCm39) Y128H probably damaging Het
Stxbp5l T C 16: 37,024,883 (GRCm39) T572A possibly damaging Het
Thada C A 17: 84,723,731 (GRCm39) V1108L possibly damaging Het
Tln1 T C 4: 43,547,756 (GRCm39) Q735R probably benign Het
Trim24 G A 6: 37,848,169 (GRCm39) E42K probably benign Het
Trnt1 T A 6: 106,754,869 (GRCm39) probably benign Het
Ttbk2 A T 2: 120,604,353 (GRCm39) M215K probably damaging Het
Ttc8 C T 12: 98,909,718 (GRCm39) probably benign Het
Ube3c A G 5: 29,795,926 (GRCm39) Y105C probably damaging Het
Unc13c A G 9: 73,438,265 (GRCm39) probably benign Het
Usp36 A G 11: 118,153,854 (GRCm39) probably benign Het
Vcf2 C T X: 149,181,360 (GRCm39) A144T probably benign Het
Vmn2r102 T C 17: 19,899,106 (GRCm39) S483P possibly damaging Het
Wdr95 A G 5: 149,511,595 (GRCm39) T432A probably damaging Het
Wnk1 G T 6: 119,903,644 (GRCm39) P2523H probably damaging Het
Xpo4 A G 14: 57,875,665 (GRCm39) probably benign Het
Zar1 G T 5: 72,737,886 (GRCm39) P71Q probably damaging Het
Zbtb41 T C 1: 139,351,348 (GRCm39) Y154H probably benign Het
Zer1 G T 2: 29,994,809 (GRCm39) probably benign Het
Zfp454 A G 11: 50,765,012 (GRCm39) F140S probably benign Het
Other mutations in Cst7
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0166:Cst7 UTSW 2 150,417,647 (GRCm39) missense probably benign 0.01
R0530:Cst7 UTSW 2 150,412,435 (GRCm39) start gained probably benign
R0620:Cst7 UTSW 2 150,417,806 (GRCm39) splice site probably benign
R1856:Cst7 UTSW 2 150,419,628 (GRCm39) missense probably damaging 1.00
R5556:Cst7 UTSW 2 150,412,488 (GRCm39) missense probably benign
R7315:Cst7 UTSW 2 150,412,503 (GRCm39) missense probably benign 0.00
R7487:Cst7 UTSW 2 150,419,624 (GRCm39) missense probably benign 0.07
R7509:Cst7 UTSW 2 150,419,624 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGCCCCAAGTCCTGAAGATGAAG -3'
(R):5'- TCAGCTTTCCAACACAGGCGAC -3'

Sequencing Primer
(F):5'- TGTACTTGCCGAGCACTTGG -3'
(R):5'- CTCAGGGTTCCAAGAGTGTC -3'
Posted On 2013-07-11