Incidental Mutation 'R6951:Esyt2'
ID541281
Institutional Source Beutler Lab
Gene Symbol Esyt2
Ensembl Gene ENSMUSG00000021171
Gene Nameextended synaptotagmin-like protein 2
Synonyms4921504I16Rik, D12Ertd551e, 2410017M09Rik, Fam62b
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6951 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location116281196-116391050 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116324130 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 223 (T223A)
Ref Sequence ENSEMBL: ENSMUSP00000152786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100986] [ENSMUST00000220720] [ENSMUST00000220816]
Predicted Effect probably benign
Transcript: ENSMUST00000100986
AA Change: T223A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000098548
Gene: ENSMUSG00000021171
AA Change: T223A

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
transmembrane domain 51 73 N/A INTRINSIC
Pfam:SMP_LBD 115 294 3e-125 PFAM
C2 310 412 1.39e-14 SMART
C2 461 556 2.59e-14 SMART
low complexity region 660 669 N/A INTRINSIC
C2 726 831 5.51e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220720
AA Change: T223A

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000220804
Predicted Effect probably benign
Transcript: ENSMUST00000220816
AA Change: T223A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Meta Mutation Damage Score 0.3403 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.0%
Validation Efficiency 100% (42/42)
MGI Phenotype PHENOTYPE: Mice are viable and fertile without overt morphological defects except reduced FGF-stimulated mouse embryonic fibroblast migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI314180 A G 4: 58,853,114 probably null Het
Ankrd34a A G 3: 96,598,422 N314S possibly damaging Het
Arhgef3 A T 14: 27,144,018 probably benign Het
Bmp1 T C 14: 70,508,858 R114G probably benign Het
Cenpf A G 1: 189,653,792 L2097P probably damaging Het
Dapk2 C G 9: 66,254,622 R271G probably benign Het
Dnase2a A T 8: 84,909,625 N130I possibly damaging Het
Dpp10 C T 1: 123,341,650 V677M possibly damaging Het
Dsp G A 13: 38,167,646 C147Y possibly damaging Het
Fndc5 G A 4: 129,138,780 V59I possibly damaging Het
Fsip2 A G 2: 82,981,949 T2871A possibly damaging Het
H2-Eb1 A T 17: 34,309,857 R121* probably null Het
Hydin A G 8: 110,398,125 I589V probably benign Het
Kitl A G 10: 100,051,852 I48V probably damaging Het
Large1 A G 8: 73,116,419 S159P probably damaging Het
Lrba T C 3: 86,745,873 L2570P probably benign Het
Mag G A 7: 30,911,433 T128I possibly damaging Het
Mb21d1 A G 9: 78,442,558 V174A probably damaging Het
Mkrn3 G T 7: 62,419,133 D303E possibly damaging Het
Myo9a A G 9: 59,894,768 D1951G probably damaging Het
Nup85 C T 11: 115,582,955 T565I possibly damaging Het
Olfr1077-ps1 T C 2: 86,525,649 H176R probably damaging Het
Olfr1156 T C 2: 87,949,979 I85V possibly damaging Het
Olfr902 A G 9: 38,448,938 D22G probably benign Het
Olfr915 A G 9: 38,646,874 S217P probably damaging Het
Pdzrn3 A T 6: 101,154,192 probably null Het
Picalm T A 7: 90,191,375 N434K probably damaging Het
Platr25 A C 13: 62,705,748 D77E probably benign Het
Prr22 A T 17: 56,772,028 R394* probably null Het
Psg23 A T 7: 18,614,711 L57Q probably damaging Het
Rap1gap2 G A 11: 74,484,948 S44L possibly damaging Het
Rffl A G 11: 82,845,750 probably null Het
Stox2 G A 8: 47,203,132 T103I probably damaging Het
Swt1 T C 1: 151,397,268 N543S possibly damaging Het
Tep1 C T 14: 50,833,913 probably null Het
Tln2 A G 9: 67,258,485 Y1023H probably damaging Het
Tssk5 C A 15: 76,372,896 R262L possibly damaging Het
Ttn C T 2: 76,880,642 probably benign Het
Ubtfl1 A T 9: 18,409,577 I134F probably benign Het
Unc80 T C 1: 66,648,511 F2351S possibly damaging Het
Vps13a A T 19: 16,723,740 D688E probably benign Het
Other mutations in Esyt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00591:Esyt2 APN 12 116363444 missense probably damaging 1.00
IGL01636:Esyt2 APN 12 116365930 critical splice donor site probably null
IGL01912:Esyt2 APN 12 116339609 missense probably damaging 1.00
IGL02310:Esyt2 APN 12 116365921 missense probably benign 0.06
PIT4802001:Esyt2 UTSW 12 116365837 missense probably benign 0.00
R0134:Esyt2 UTSW 12 116367710 missense probably damaging 0.98
R0225:Esyt2 UTSW 12 116367710 missense probably damaging 0.98
R0313:Esyt2 UTSW 12 116347808 missense probably damaging 1.00
R0532:Esyt2 UTSW 12 116357198 splice site probably benign
R2324:Esyt2 UTSW 12 116367821 missense possibly damaging 0.50
R4610:Esyt2 UTSW 12 116318890 missense probably damaging 0.99
R4898:Esyt2 UTSW 12 116342088 missense probably benign 0.06
R4918:Esyt2 UTSW 12 116324140 missense probably benign 0.30
R5052:Esyt2 UTSW 12 116367796 missense probably damaging 1.00
R5222:Esyt2 UTSW 12 116318826 missense probably damaging 1.00
R5800:Esyt2 UTSW 12 116370188 missense possibly damaging 0.94
R6499:Esyt2 UTSW 12 116321170 missense probably damaging 0.98
R6607:Esyt2 UTSW 12 116368740 missense probably benign 0.18
R7153:Esyt2 UTSW 12 116346508 missense probably benign 0.00
R7173:Esyt2 UTSW 12 116363534 missense probably benign 0.05
R7227:Esyt2 UTSW 12 116342125 missense probably damaging 1.00
R7248:Esyt2 UTSW 12 116342238 missense probably damaging 1.00
R7509:Esyt2 UTSW 12 116365876 missense probably damaging 1.00
R7780:Esyt2 UTSW 12 116342098 missense probably benign 0.15
R8077:Esyt2 UTSW 12 116342228 missense possibly damaging 0.54
R8136:Esyt2 UTSW 12 116363459 missense probably benign
R8264:Esyt2 UTSW 12 116365920 missense probably benign 0.00
R8350:Esyt2 UTSW 12 116363482 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTAGAGCTGGTGTGAAAAGTATTC -3'
(R):5'- GGGCAGAATTTTGATCCTCCATTC -3'

Sequencing Primer
(F):5'- TAGACTGTATTCAGAAAGAAAAGCTG -3'
(R):5'- CAGAATTTTGATCCTCCATTCTATCC -3'
Posted On2018-11-28