Incidental Mutation 'R6951:Arhgef3'
ID541283
Institutional Source Beutler Lab
Gene Symbol Arhgef3
Ensembl Gene ENSMUSG00000021895
Gene NameRho guanine nucleotide exchange factor (GEF) 3
Synonyms9830169H03Rik, 1200004I24Rik, C76747
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R6951 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location27114899-27403911 bp(+) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) A to T at 27144018 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153396 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000225949
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.0%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho-like GTPases are involved in a variety of cellular processes, and they are activated by binding GTP and inactivated by conversion of GTP to GDP by their intrinsic GTPase activity. Guanine nucleotide exchange factors (GEFs) accelerate the GTPase activity of Rho GTPases by catalyzing their release of bound GDP. This gene encodes a guanine nucleotide exchange factor, which specifically activates two members of the Rho GTPase family: RHOA and RHOB, both of which have a role in bone cell biology. It has been identified that genetic variation in this gene plays a role in the determination of bone mineral density (BMD), indicating the implication of this gene in postmenopausal osteoporosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased mean platelet volume and a mild delay in platelet recovery in response to thrombocytopenia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI314180 A G 4: 58,853,114 probably null Het
Ankrd34a A G 3: 96,598,422 N314S possibly damaging Het
Bmp1 T C 14: 70,508,858 R114G probably benign Het
Cenpf A G 1: 189,653,792 L2097P probably damaging Het
Dapk2 C G 9: 66,254,622 R271G probably benign Het
Dnase2a A T 8: 84,909,625 N130I possibly damaging Het
Dpp10 C T 1: 123,341,650 V677M possibly damaging Het
Dsp G A 13: 38,167,646 C147Y possibly damaging Het
Esyt2 A G 12: 116,324,130 T223A probably benign Het
Fndc5 G A 4: 129,138,780 V59I possibly damaging Het
Fsip2 A G 2: 82,981,949 T2871A possibly damaging Het
H2-Eb1 A T 17: 34,309,857 R121* probably null Het
Hydin A G 8: 110,398,125 I589V probably benign Het
Kitl A G 10: 100,051,852 I48V probably damaging Het
Large1 A G 8: 73,116,419 S159P probably damaging Het
Lrba T C 3: 86,745,873 L2570P probably benign Het
Mag G A 7: 30,911,433 T128I possibly damaging Het
Mb21d1 A G 9: 78,442,558 V174A probably damaging Het
Mkrn3 G T 7: 62,419,133 D303E possibly damaging Het
Myo9a A G 9: 59,894,768 D1951G probably damaging Het
Nup85 C T 11: 115,582,955 T565I possibly damaging Het
Olfr1077-ps1 T C 2: 86,525,649 H176R probably damaging Het
Olfr1156 T C 2: 87,949,979 I85V possibly damaging Het
Olfr902 A G 9: 38,448,938 D22G probably benign Het
Olfr915 A G 9: 38,646,874 S217P probably damaging Het
Pdzrn3 A T 6: 101,154,192 probably null Het
Picalm T A 7: 90,191,375 N434K probably damaging Het
Platr25 A C 13: 62,705,748 D77E probably benign Het
Prr22 A T 17: 56,772,028 R394* probably null Het
Psg23 A T 7: 18,614,711 L57Q probably damaging Het
Rap1gap2 G A 11: 74,484,948 S44L possibly damaging Het
Rffl A G 11: 82,845,750 probably null Het
Stox2 G A 8: 47,203,132 T103I probably damaging Het
Swt1 T C 1: 151,397,268 N543S possibly damaging Het
Tep1 C T 14: 50,833,913 probably null Het
Tln2 A G 9: 67,258,485 Y1023H probably damaging Het
Tssk5 C A 15: 76,372,896 R262L possibly damaging Het
Ttn C T 2: 76,880,642 probably benign Het
Ubtfl1 A T 9: 18,409,577 I134F probably benign Het
Unc80 T C 1: 66,648,511 F2351S possibly damaging Het
Vps13a A T 19: 16,723,740 D688E probably benign Het
Other mutations in Arhgef3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Arhgef3 APN 14 27401919 nonsense probably null
IGL02178:Arhgef3 APN 14 27265529 nonsense probably null
IGL02302:Arhgef3 APN 14 27362842 missense probably benign 0.08
IGL02505:Arhgef3 APN 14 27394000 missense possibly damaging 0.92
IGL03203:Arhgef3 APN 14 27394116 missense probably damaging 1.00
IGL03339:Arhgef3 APN 14 27401857 missense probably damaging 0.99
R0762:Arhgef3 UTSW 14 27397627 missense probably damaging 1.00
R1192:Arhgef3 UTSW 14 27379706 missense probably damaging 1.00
R1572:Arhgef3 UTSW 14 27401735 missense probably damaging 1.00
R1794:Arhgef3 UTSW 14 27397605 missense probably benign 0.44
R2426:Arhgef3 UTSW 14 27384181 nonsense probably null
R2509:Arhgef3 UTSW 14 27379676 missense probably damaging 1.00
R4932:Arhgef3 UTSW 14 27384213 missense probably damaging 0.99
R5017:Arhgef3 UTSW 14 27265530 missense possibly damaging 0.85
R5216:Arhgef3 UTSW 14 27401842 missense probably benign 0.00
R6562:Arhgef3 UTSW 14 27152996 start gained probably benign
R7140:Arhgef3 UTSW 14 27401707 missense probably damaging 1.00
R7361:Arhgef3 UTSW 14 27265578 missense possibly damaging 0.56
R8042:Arhgef3 UTSW 14 27362809 missense possibly damaging 0.85
R8077:Arhgef3 UTSW 14 27385924 missense probably damaging 1.00
R8303:Arhgef3 UTSW 14 27394138 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AACTTTGCCTTGTCAGGGGATC -3'
(R):5'- CGCTCTCAAGACAAGTCCATTTG -3'

Sequencing Primer
(F):5'- CAGGGGATCCAGTTTTAAAGCTTC -3'
(R):5'- CTCAAGACAAGTCCATTTGTGGGAAG -3'
Posted On2018-11-28