Incidental Mutation 'R6951:Bmp1'
ID 541285
Institutional Source Beutler Lab
Gene Symbol Bmp1
Ensembl Gene ENSMUSG00000022098
Gene Name bone morphogenetic protein 1
Synonyms
MMRRC Submission 045063-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6951 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 70711998-70757674 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 70746298 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 114 (R114G)
Ref Sequence ENSEMBL: ENSMUSP00000154610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022693] [ENSMUST00000226246] [ENSMUST00000226906] [ENSMUST00000227944]
AlphaFold P98063
Predicted Effect probably benign
Transcript: ENSMUST00000022693
AA Change: R114G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022693
Gene: ENSMUSG00000022098
AA Change: R114G

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
ZnMc 131 273 1.32e-54 SMART
CUB 327 439 4.35e-43 SMART
CUB 440 552 7.86e-50 SMART
EGF_CA 552 593 5.03e-11 SMART
CUB 596 708 1.13e-50 SMART
EGF_CA 708 748 4.81e-8 SMART
CUB 752 864 3.99e-51 SMART
CUB 865 981 7.35e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226246
AA Change: R114G

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000226906
AA Change: R114G

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000227944
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.0%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: This gene encodes a metalloproteinase that plays an essential role in the formation of the extracellular matrix and is also able to induce ectopic bone formation. Unlike other bone morphogenetic proteins, the protein encoded by this gene is not closely related to transforming growth factor-beta. This protein plays in role several developmental processes. In humans, mutations in this gene are associated with osteogenesis imperfecta and with increased bone mineral density and multiple recurrent fractures. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous targeted mutant embryos have reduced ossification of the skull, persistent herniation of the gut, abnormal collagen fibrils in the amnion, and die at birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd34a A G 3: 96,505,738 (GRCm39) N314S possibly damaging Het
Arhgef3 A T 14: 26,865,975 (GRCm39) probably benign Het
Cenpf A G 1: 189,385,989 (GRCm39) L2097P probably damaging Het
Cgas A G 9: 78,349,840 (GRCm39) V174A probably damaging Het
Dapk2 C G 9: 66,161,904 (GRCm39) R271G probably benign Het
Dnase2a A T 8: 85,636,254 (GRCm39) N130I possibly damaging Het
Dpp10 C T 1: 123,269,379 (GRCm39) V677M possibly damaging Het
Dsp G A 13: 38,351,622 (GRCm39) C147Y possibly damaging Het
Ecpas A G 4: 58,853,114 (GRCm39) probably null Het
Esyt2 A G 12: 116,287,750 (GRCm39) T223A probably benign Het
Fndc5 G A 4: 129,032,573 (GRCm39) V59I possibly damaging Het
Fsip2 A G 2: 82,812,293 (GRCm39) T2871A possibly damaging Het
H2-Eb1 A T 17: 34,528,831 (GRCm39) R121* probably null Het
Hydin A G 8: 111,124,757 (GRCm39) I589V probably benign Het
Kitl A G 10: 99,887,714 (GRCm39) I48V probably damaging Het
Large1 A G 8: 73,843,047 (GRCm39) S159P probably damaging Het
Lrba T C 3: 86,653,180 (GRCm39) L2570P probably benign Het
Mag G A 7: 30,610,858 (GRCm39) T128I possibly damaging Het
Mkrn3 G T 7: 62,068,881 (GRCm39) D303E possibly damaging Het
Myo9a A G 9: 59,802,051 (GRCm39) D1951G probably damaging Het
Nup85 C T 11: 115,473,781 (GRCm39) T565I possibly damaging Het
Or5l13 T C 2: 87,780,323 (GRCm39) I85V possibly damaging Het
Or8b1d A G 9: 38,558,170 (GRCm39) S217P probably damaging Het
Or8b43 A G 9: 38,360,234 (GRCm39) D22G probably benign Het
Or8k31-ps1 T C 2: 86,355,993 (GRCm39) H176R probably damaging Het
Pdzrn3 A T 6: 101,131,153 (GRCm39) probably null Het
Picalm T A 7: 89,840,583 (GRCm39) N434K probably damaging Het
Platr25 A C 13: 62,853,562 (GRCm39) D77E probably benign Het
Prr22 A T 17: 57,079,028 (GRCm39) R394* probably null Het
Psg23 A T 7: 18,348,636 (GRCm39) L57Q probably damaging Het
Rap1gap2 G A 11: 74,375,774 (GRCm39) S44L possibly damaging Het
Rffl A G 11: 82,736,576 (GRCm39) probably null Het
Stox2 G A 8: 47,656,167 (GRCm39) T103I probably damaging Het
Swt1 T C 1: 151,273,019 (GRCm39) N543S possibly damaging Het
Tep1 C T 14: 51,071,370 (GRCm39) probably null Het
Tln2 A G 9: 67,165,767 (GRCm39) Y1023H probably damaging Het
Tssk5 C A 15: 76,257,096 (GRCm39) R262L possibly damaging Het
Ttn C T 2: 76,710,986 (GRCm39) probably benign Het
Ubtfl1 A T 9: 18,320,873 (GRCm39) I134F probably benign Het
Unc80 T C 1: 66,687,670 (GRCm39) F2351S possibly damaging Het
Vps13a A T 19: 16,701,104 (GRCm39) D688E probably benign Het
Other mutations in Bmp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Bmp1 APN 14 70,729,901 (GRCm39) missense probably damaging 1.00
IGL02065:Bmp1 APN 14 70,727,547 (GRCm39) missense probably damaging 0.99
IGL02065:Bmp1 APN 14 70,723,660 (GRCm39) missense probably damaging 0.97
IGL02349:Bmp1 APN 14 70,744,989 (GRCm39) missense possibly damaging 0.61
IGL02486:Bmp1 APN 14 70,742,216 (GRCm39) missense possibly damaging 0.48
PIT4519001:Bmp1 UTSW 14 70,727,469 (GRCm39) missense possibly damaging 0.65
R0394:Bmp1 UTSW 14 70,727,474 (GRCm39) missense probably damaging 0.99
R1371:Bmp1 UTSW 14 70,729,906 (GRCm39) missense probably damaging 1.00
R1604:Bmp1 UTSW 14 70,745,444 (GRCm39) missense possibly damaging 0.66
R1732:Bmp1 UTSW 14 70,723,705 (GRCm39) missense possibly damaging 0.67
R1834:Bmp1 UTSW 14 70,746,271 (GRCm39) missense possibly damaging 0.73
R2008:Bmp1 UTSW 14 70,729,906 (GRCm39) missense probably damaging 1.00
R2197:Bmp1 UTSW 14 70,723,712 (GRCm39) missense possibly damaging 0.83
R3157:Bmp1 UTSW 14 70,729,547 (GRCm39) missense possibly damaging 0.63
R4397:Bmp1 UTSW 14 70,727,982 (GRCm39) splice site probably null
R4609:Bmp1 UTSW 14 70,715,406 (GRCm39) missense probably benign 0.00
R4613:Bmp1 UTSW 14 70,745,963 (GRCm39) missense probably damaging 1.00
R4675:Bmp1 UTSW 14 70,730,284 (GRCm39) missense probably damaging 0.99
R4796:Bmp1 UTSW 14 70,729,513 (GRCm39) splice site probably null
R4884:Bmp1 UTSW 14 70,712,655 (GRCm39) missense probably benign 0.01
R4905:Bmp1 UTSW 14 70,728,802 (GRCm39) missense probably benign 0.06
R5088:Bmp1 UTSW 14 70,723,659 (GRCm39) missense possibly damaging 0.84
R5225:Bmp1 UTSW 14 70,717,605 (GRCm39) missense probably damaging 0.97
R5271:Bmp1 UTSW 14 70,745,568 (GRCm39) missense probably benign 0.34
R5625:Bmp1 UTSW 14 70,723,606 (GRCm39) missense probably benign 0.19
R5653:Bmp1 UTSW 14 70,727,534 (GRCm39) missense probably benign 0.00
R6155:Bmp1 UTSW 14 70,745,447 (GRCm39) missense probably damaging 1.00
R6295:Bmp1 UTSW 14 70,728,823 (GRCm39) missense possibly damaging 0.88
R6618:Bmp1 UTSW 14 70,728,808 (GRCm39) missense probably damaging 1.00
R6649:Bmp1 UTSW 14 70,728,058 (GRCm39) missense probably damaging 1.00
R6653:Bmp1 UTSW 14 70,728,058 (GRCm39) missense probably damaging 1.00
R6983:Bmp1 UTSW 14 70,745,647 (GRCm39) missense probably damaging 0.96
R7207:Bmp1 UTSW 14 70,717,000 (GRCm39) missense possibly damaging 0.56
R7500:Bmp1 UTSW 14 70,727,562 (GRCm39) missense probably benign 0.44
R7716:Bmp1 UTSW 14 70,715,362 (GRCm39) nonsense probably null
R7749:Bmp1 UTSW 14 70,730,284 (GRCm39) missense probably damaging 1.00
R7763:Bmp1 UTSW 14 70,729,524 (GRCm39) missense probably damaging 1.00
R7834:Bmp1 UTSW 14 70,746,005 (GRCm39) missense probably damaging 1.00
R8232:Bmp1 UTSW 14 70,757,329 (GRCm39) missense probably damaging 0.97
R8490:Bmp1 UTSW 14 70,727,573 (GRCm39) missense possibly damaging 0.94
R8827:Bmp1 UTSW 14 70,728,082 (GRCm39) missense probably damaging 1.00
R8945:Bmp1 UTSW 14 70,727,630 (GRCm39) missense probably damaging 1.00
R9178:Bmp1 UTSW 14 70,727,613 (GRCm39) missense possibly damaging 0.78
R9228:Bmp1 UTSW 14 70,757,338 (GRCm39) missense probably benign
R9621:Bmp1 UTSW 14 70,715,306 (GRCm39) missense probably benign 0.29
R9652:Bmp1 UTSW 14 70,715,360 (GRCm39) missense probably damaging 1.00
X0028:Bmp1 UTSW 14 70,745,977 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACAGTGTTACAGCCAGTCCG -3'
(R):5'- TGACCGTATCGATTTGAGACTAGC -3'

Sequencing Primer
(F):5'- GCACACTGCCTGGCCAG -3'
(R):5'- GCAAGTAAATTTTTAGCAAAGTAGGC -3'
Posted On 2018-11-28