Incidental Mutation 'R6953:Spag17'
ID541302
Institutional Source Beutler Lab
Gene Symbol Spag17
Ensembl Gene ENSMUSG00000027867
Gene Namesperm associated antigen 17
Synonyms4931427F14Rik, PF6
MMRRC Submission
Accession Numbers

Genbank: NM_028892; MGI: 1921612

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6953 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location99885406-100143322 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 100034975 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 772 (I772S)
Ref Sequence ENSEMBL: ENSMUSP00000134066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164539]
Predicted Effect possibly damaging
Transcript: ENSMUST00000164539
AA Change: I772S

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000134066
Gene: ENSMUSG00000027867
AA Change: I772S

DomainStartEndE-ValueType
low complexity region 155 170 N/A INTRINSIC
low complexity region 384 400 N/A INTRINSIC
low complexity region 876 887 N/A INTRINSIC
coiled coil region 909 964 N/A INTRINSIC
coiled coil region 1079 1120 N/A INTRINSIC
low complexity region 1179 1190 N/A INTRINSIC
low complexity region 1192 1205 N/A INTRINSIC
low complexity region 1209 1220 N/A INTRINSIC
low complexity region 1223 1238 N/A INTRINSIC
low complexity region 1394 1405 N/A INTRINSIC
low complexity region 1931 1942 N/A INTRINSIC
Pfam:PapD-like 2171 2277 1.2e-15 PFAM
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a central pair protein present in the axonemes of cells with a "9 + 2" organization of microtubules. The encoded protein is required for the proper function of the axoneme. Mutations in the orthologous gene in mice lead to primary ciliary dyskinesia characterized by immotile nasal and tracheal cilia, reduced clearance of nasal mucus, profound respiratory distress, hydrocephalus, and neonatal lethality within twelve hours of birth due to impaired airway mucociliary clearance. Single-nucleotide polymorphisms in this gene are associated with human height and targeted mutations lead to skeletal malformations affecting the limbs in mice, suggesting a role for this gene in skeletal development. [provided by RefSeq, Feb 2017]
PHENOTYPE: Homozygous null mice exhibit immotile respiratory cilia with axoneme structural defects, impaired mucociliary clearance, respiratory distress, pulmonary edema, disrupted alveolar epithelium, enlarged brain ventricles consistent with evolving hydrocephalus, failure to suckle, and neonatal lethality. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik C A 15: 58,028,827 S128I probably damaging Het
Aadacl2 A C 3: 60,024,760 H232P possibly damaging Het
Abcc3 A G 11: 94,374,835 Y125H probably benign Het
Adgrb3 A G 1: 25,826,511 S84P probably damaging Het
Adgrd1 A T 5: 129,115,078 K71* probably null Het
Ap2m1 T A 16: 20,542,718 W381R probably damaging Het
Ascc3 A G 10: 50,645,666 I426V probably benign Het
BC024063 T A 10: 82,107,899 D31E possibly damaging Het
C3ar1 G A 6: 122,850,632 H209Y possibly damaging Het
Ccp110 T C 7: 118,722,421 V433A possibly damaging Het
Cfap54 A G 10: 92,994,678 S1199P probably benign Het
Cyp24a1 T G 2: 170,487,946 D362A probably benign Het
Dapk2 C G 9: 66,254,622 R271G probably benign Het
Dnmt1 G T 9: 20,918,526 Q633K probably benign Het
Ercc4 T A 16: 13,130,686 V499D probably damaging Het
Ier3ip1 C G 18: 76,939,613 P46R probably damaging Het
Ifi211 T C 1: 173,906,266 T110A probably damaging Het
Isoc1 A G 18: 58,671,302 D134G possibly damaging Het
Kif26b A G 1: 178,874,072 D672G possibly damaging Het
Klhl33 T A 14: 50,891,516 D752V possibly damaging Het
Lcn4 A G 2: 26,669,355 Y133H probably benign Het
Mrs2 C A 13: 25,001,788 V134L probably benign Het
Muc16 T C 9: 18,640,529 T4823A probably benign Het
Ogfod3 A G 11: 121,202,998 I62T probably benign Het
Olfr1380 A G 11: 49,564,290 Y123C probably damaging Het
Olfr165 C T 16: 19,407,528 V164I probably benign Het
Olfr773 A T 10: 129,186,605 M272K probably benign Het
Olfr869 A T 9: 20,138,003 I296L probably benign Het
Papln G A 12: 83,781,885 W788* probably null Het
Pcdhac2 A G 18: 37,144,426 Q153R probably benign Het
Pcdhgb2 C T 18: 37,690,754 T266I possibly damaging Het
Pcdhgc5 C A 18: 37,820,461 R263S possibly damaging Het
Phactr4 T C 4: 132,377,351 T185A possibly damaging Het
Plcxd2 T C 16: 45,980,519 D114G probably damaging Het
Polr2a A T 11: 69,741,711 I987N probably damaging Het
Prl3d3 A G 13: 27,161,046 M134V probably benign Het
Pum2 T A 12: 8,728,779 probably null Het
Racgap1 T C 15: 99,626,329 E399G probably damaging Het
Sbspon A T 1: 15,860,295 S156T probably damaging Het
Scn1a T C 2: 66,319,469 T927A probably damaging Het
Sec23ip C A 7: 128,752,796 S78* probably null Het
Serpina1d G A 12: 103,767,730 T105I probably benign Het
Slc25a21 T A 12: 57,159,169 N26Y probably benign Het
Smim20 T A 5: 53,277,916 D64E probably damaging Het
Tars2 T C 3: 95,753,114 T99A possibly damaging Het
Tdrd1 C T 19: 56,831,371 T101I probably damaging Het
Tldc2 T G 2: 157,089,278 probably null Het
Ttn A G 2: 76,771,585 Y10251H probably damaging Het
Ush2a A G 1: 188,263,145 R38G possibly damaging Het
Usp19 T C 9: 108,498,931 L991P possibly damaging Het
Vmn2r109 G A 17: 20,540,711 P795S possibly damaging Het
Vmn2r26 T C 6: 124,039,782 Y402H probably benign Het
Vmn2r-ps117 T G 17: 18,824,833 I504R probably benign Het
Zfp551 A T 7: 12,416,788 C231* probably null Het
Zfp607a T A 7: 27,878,365 C287S possibly damaging Het
Zim1 T A 7: 6,687,707 T40S unknown Het
Other mutations in Spag17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Spag17 APN 3 100063375 missense probably benign 0.00
IGL01143:Spag17 APN 3 99939298 missense probably benign 0.00
IGL01329:Spag17 APN 3 100095549 missense probably benign 0.16
IGL01393:Spag17 APN 3 100027610 missense possibly damaging 0.53
IGL01617:Spag17 APN 3 100109508 missense possibly damaging 0.65
IGL01705:Spag17 APN 3 100022730 missense probably benign 0.01
IGL01928:Spag17 APN 3 99940074 splice site probably benign
IGL01981:Spag17 APN 3 100058833 missense probably benign 0.03
IGL02435:Spag17 APN 3 99982444 missense possibly damaging 0.53
IGL02452:Spag17 APN 3 100027391 missense probably benign 0.00
IGL02465:Spag17 APN 3 100075871 missense probably damaging 0.96
IGL02615:Spag17 APN 3 100072085 missense probably benign 0.09
IGL02751:Spag17 APN 3 100010794 nonsense probably null
IGL02803:Spag17 APN 3 100109397 missense probably benign
IGL02898:Spag17 APN 3 100101386 missense probably benign 0.00
IGL03037:Spag17 APN 3 100072170 splice site probably null
IGL03068:Spag17 APN 3 100080205 missense probably benign 0.35
IGL03131:Spag17 APN 3 100010759 missense possibly damaging 0.85
IGL03224:Spag17 APN 3 100010840 missense possibly damaging 0.53
FR4342:Spag17 UTSW 3 100056249 small insertion probably benign
FR4342:Spag17 UTSW 3 100056252 small insertion probably benign
FR4548:Spag17 UTSW 3 100056254 small insertion probably benign
FR4589:Spag17 UTSW 3 100056245 small insertion probably benign
FR4589:Spag17 UTSW 3 100056258 small insertion probably benign
FR4737:Spag17 UTSW 3 100056257 small insertion probably benign
FR4976:Spag17 UTSW 3 100056254 small insertion probably benign
FR4976:Spag17 UTSW 3 100056255 small insertion probably benign
N/A:Spag17 UTSW 3 99982254 splice site probably benign
PIT4504001:Spag17 UTSW 3 100103110 critical splice acceptor site probably null
PIT4514001:Spag17 UTSW 3 100013211 missense possibly damaging 0.53
R0107:Spag17 UTSW 3 100050787 missense possibly damaging 0.72
R0230:Spag17 UTSW 3 100106827 missense probably benign 0.08
R0243:Spag17 UTSW 3 100085368 missense probably benign 0.04
R0321:Spag17 UTSW 3 100101403 missense probably damaging 0.99
R0375:Spag17 UTSW 3 100027590 missense probably benign
R0417:Spag17 UTSW 3 100065554 missense probably benign 0.11
R0490:Spag17 UTSW 3 99982411 missense probably damaging 0.97
R0537:Spag17 UTSW 3 100125302 missense probably damaging 0.98
R0714:Spag17 UTSW 3 100080156 missense probably damaging 0.97
R0844:Spag17 UTSW 3 100004785 missense probably benign
R0919:Spag17 UTSW 3 100071943 splice site probably benign
R0926:Spag17 UTSW 3 100072116 missense probably benign
R1037:Spag17 UTSW 3 100103117 missense probably benign 0.01
R1075:Spag17 UTSW 3 100093676 missense probably damaging 0.99
R1109:Spag17 UTSW 3 100027351 missense possibly damaging 0.86
R1213:Spag17 UTSW 3 100095638 missense probably benign 0.01
R1221:Spag17 UTSW 3 99982268 missense possibly damaging 0.72
R1576:Spag17 UTSW 3 99939363 missense possibly damaging 0.73
R1586:Spag17 UTSW 3 100021752 missense possibly damaging 0.53
R1768:Spag17 UTSW 3 100027352 missense possibly damaging 0.53
R1782:Spag17 UTSW 3 100010754 missense probably benign 0.02
R1789:Spag17 UTSW 3 99939356 missense possibly damaging 0.73
R1945:Spag17 UTSW 3 99939982 missense probably benign
R2065:Spag17 UTSW 3 100013208 missense probably benign 0.03
R2118:Spag17 UTSW 3 100049240 missense possibly damaging 0.72
R2265:Spag17 UTSW 3 100061866 splice site probably null
R2266:Spag17 UTSW 3 100061866 splice site probably null
R2267:Spag17 UTSW 3 100061866 splice site probably null
R2268:Spag17 UTSW 3 100061866 splice site probably null
R2271:Spag17 UTSW 3 100106797 missense probably damaging 1.00
R2389:Spag17 UTSW 3 100106837 missense probably benign 0.27
R2420:Spag17 UTSW 3 100027619 missense probably benign
R2422:Spag17 UTSW 3 100027619 missense probably benign
R2423:Spag17 UTSW 3 100103456 missense probably benign
R3407:Spag17 UTSW 3 100085299 missense probably benign 0.09
R3801:Spag17 UTSW 3 100053853 missense possibly damaging 0.53
R3856:Spag17 UTSW 3 100106759 missense probably damaging 1.00
R4021:Spag17 UTSW 3 100049230 missense probably benign 0.00
R4022:Spag17 UTSW 3 100049230 missense probably benign 0.00
R4408:Spag17 UTSW 3 100103378 missense probably benign
R4468:Spag17 UTSW 3 100085366 missense probably damaging 0.98
R4540:Spag17 UTSW 3 100088381 missense probably damaging 1.00
R4621:Spag17 UTSW 3 100103243 missense probably benign 0.08
R4622:Spag17 UTSW 3 100103243 missense probably benign 0.08
R4756:Spag17 UTSW 3 100103385 missense possibly damaging 0.68
R4797:Spag17 UTSW 3 99984479 missense possibly damaging 0.70
R4855:Spag17 UTSW 3 100063333 missense probably benign 0.02
R4887:Spag17 UTSW 3 100050831 missense probably damaging 1.00
R4962:Spag17 UTSW 3 100027623 missense probably benign
R5030:Spag17 UTSW 3 100085341 nonsense probably null
R5042:Spag17 UTSW 3 100072149 missense probably damaging 1.00
R5074:Spag17 UTSW 3 100080118 missense possibly damaging 0.94
R5195:Spag17 UTSW 3 100101388 missense probably benign 0.16
R5200:Spag17 UTSW 3 100063471 nonsense probably null
R5267:Spag17 UTSW 3 100061948 missense probably damaging 0.98
R5360:Spag17 UTSW 3 100109410 missense probably benign 0.00
R5444:Spag17 UTSW 3 100056152 missense probably benign 0.06
R5498:Spag17 UTSW 3 100103345 missense possibly damaging 0.83
R5503:Spag17 UTSW 3 100027244 missense possibly damaging 0.72
R5540:Spag17 UTSW 3 100056272 missense possibly damaging 0.91
R5547:Spag17 UTSW 3 100056152 missense probably benign 0.06
R5575:Spag17 UTSW 3 100053822 missense possibly damaging 0.85
R5629:Spag17 UTSW 3 100080119 missense probably benign 0.33
R5639:Spag17 UTSW 3 100056166 missense probably damaging 1.00
R5842:Spag17 UTSW 3 99939250 missense possibly damaging 0.85
R5976:Spag17 UTSW 3 100095791 nonsense probably null
R6082:Spag17 UTSW 3 100124185 missense possibly damaging 0.46
R6228:Spag17 UTSW 3 100022602 missense probably benign 0.33
R6254:Spag17 UTSW 3 100065585 missense probably benign 0.03
R6321:Spag17 UTSW 3 100088427 missense probably benign 0.05
R6446:Spag17 UTSW 3 100103132 missense probably benign
R6687:Spag17 UTSW 3 100092950 missense probably benign 0.07
R6853:Spag17 UTSW 3 100013235 missense possibly damaging 0.86
R6946:Spag17 UTSW 3 100004683 missense possibly damaging 0.53
R7038:Spag17 UTSW 3 99984609 missense probably benign 0.00
R7084:Spag17 UTSW 3 99939270 missense probably benign 0.18
R7126:Spag17 UTSW 3 100101435 missense probably benign 0.00
R7144:Spag17 UTSW 3 100027401 splice site probably null
R7198:Spag17 UTSW 3 100095572 missense probably benign 0.02
R7318:Spag17 UTSW 3 99939983 missense probably benign 0.00
R7403:Spag17 UTSW 3 99939375 missense possibly damaging 0.53
R7409:Spag17 UTSW 3 100027231 missense possibly damaging 0.73
R7409:Spag17 UTSW 3 100034159 missense probably benign 0.00
R7537:Spag17 UTSW 3 99939247 missense possibly damaging 0.96
X0025:Spag17 UTSW 3 100101451 missense probably benign 0.31
Z1088:Spag17 UTSW 3 100095630 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CCTAACAGGGCTCCATTTGG -3'
(R):5'- TGGCATTGCTTCCTAGTACAGATG -3'

Sequencing Primer
(F):5'- TAACAGGGCTCCATTTGGACTCAC -3'
(R):5'- TGGAAGCAGAAGTATTTCCAACC -3'
Posted On2018-11-28