Incidental Mutation 'R6953:Muc16'
ID 541313
Institutional Source Beutler Lab
Gene Symbol Muc16
Ensembl Gene ENSMUSG00000109564
Gene Name mucin 16
Synonyms 1110008I14Rik, LOC385009
MMRRC Submission 045065-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.180) question?
Stock # R6953 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 18495455-18674530 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 18640529 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 4823 (T4823A)
Ref Sequence ENSEMBL: ENSMUSP00000147104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000208663]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000208663
AA Change: T4823A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency 98% (54/55)
MGI Phenotype PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik C A 15: 58,028,827 S128I probably damaging Het
Aadacl2 A C 3: 60,024,760 H232P possibly damaging Het
Abcc3 A G 11: 94,374,835 Y125H probably benign Het
Adgrb3 A G 1: 25,826,511 S84P probably damaging Het
Adgrd1 A T 5: 129,115,078 K71* probably null Het
Ap2m1 T A 16: 20,542,718 W381R probably damaging Het
Ascc3 A G 10: 50,645,666 I426V probably benign Het
BC024063 T A 10: 82,107,899 D31E possibly damaging Het
C3ar1 G A 6: 122,850,632 H209Y possibly damaging Het
Ccp110 T C 7: 118,722,421 V433A possibly damaging Het
Cfap54 A G 10: 92,994,678 S1199P probably benign Het
Cyp24a1 T G 2: 170,487,946 D362A probably benign Het
Dapk2 C G 9: 66,254,622 R271G probably benign Het
Dnmt1 G T 9: 20,918,526 Q633K probably benign Het
Ercc4 T A 16: 13,130,686 V499D probably damaging Het
Ier3ip1 C G 18: 76,939,613 P46R probably damaging Het
Ifi211 T C 1: 173,906,266 T110A probably damaging Het
Isoc1 A G 18: 58,671,302 D134G possibly damaging Het
Kif26b A G 1: 178,874,072 D672G possibly damaging Het
Klhl33 T A 14: 50,891,516 D752V possibly damaging Het
Lcn4 A G 2: 26,669,355 Y133H probably benign Het
Mrs2 C A 13: 25,001,788 V134L probably benign Het
Ogfod3 A G 11: 121,202,998 I62T probably benign Het
Olfr1380 A G 11: 49,564,290 Y123C probably damaging Het
Olfr165 C T 16: 19,407,528 V164I probably benign Het
Olfr773 A T 10: 129,186,605 M272K probably benign Het
Olfr869 A T 9: 20,138,003 I296L probably benign Het
Papln G A 12: 83,781,885 W788* probably null Het
Pcdhac2 A G 18: 37,144,426 Q153R probably benign Het
Pcdhgb2 C T 18: 37,690,754 T266I possibly damaging Het
Pcdhgc5 C A 18: 37,820,461 R263S possibly damaging Het
Phactr4 T C 4: 132,377,351 T185A possibly damaging Het
Plcxd2 T C 16: 45,980,519 D114G probably damaging Het
Polr2a A T 11: 69,741,711 I987N probably damaging Het
Prl3d3 A G 13: 27,161,046 M134V probably benign Het
Pum2 T A 12: 8,728,779 probably null Het
Racgap1 T C 15: 99,626,329 E399G probably damaging Het
Sbspon A T 1: 15,860,295 S156T probably damaging Het
Scn1a T C 2: 66,319,469 T927A probably damaging Het
Sec23ip C A 7: 128,752,796 S78* probably null Het
Serpina1d G A 12: 103,767,730 T105I probably benign Het
Slc25a21 T A 12: 57,159,169 N26Y probably benign Het
Smim20 T A 5: 53,277,916 D64E probably damaging Het
Spag17 T G 3: 100,034,975 I772S possibly damaging Het
Tars2 T C 3: 95,753,114 T99A possibly damaging Het
Tdrd1 C T 19: 56,831,371 T101I probably damaging Het
Tldc2 T G 2: 157,089,278 probably null Het
Ttn A G 2: 76,771,585 Y10251H probably damaging Het
Ush2a A G 1: 188,263,145 R38G possibly damaging Het
Usp19 T C 9: 108,498,931 L991P possibly damaging Het
Vmn2r109 G A 17: 20,540,711 P795S possibly damaging Het
Vmn2r26 T C 6: 124,039,782 Y402H probably benign Het
Vmn2r-ps117 T G 17: 18,824,833 I504R probably benign Het
Zfp551 A T 7: 12,416,788 C231* probably null Het
Zfp607a T A 7: 27,878,365 C287S possibly damaging Het
Zim1 T A 7: 6,687,707 T40S unknown Het
Other mutations in Muc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Muc16 APN 9 18508507 missense possibly damaging 0.89
IGL01878:Muc16 APN 9 18495543 missense possibly damaging 0.90
IGL02394:Muc16 APN 9 18498700 missense probably damaging 0.99
IGL02553:Muc16 APN 9 18498553 critical splice donor site probably null
Brimming UTSW 9 18592680 missense probably damaging 0.99
R7038_muc16_859 UTSW 9 18620468 missense probably damaging 0.99
Runneymeade UTSW 9 18579317 critical splice donor site probably null
slimey UTSW 9 18590698 missense probably damaging 1.00
viscous UTSW 9 18644732 missense unknown
R0400:Muc16 UTSW 9 18510534 missense possibly damaging 0.74
R1620:Muc16 UTSW 9 18510477 missense possibly damaging 0.89
R1695:Muc16 UTSW 9 18497433 missense probably damaging 1.00
R3196:Muc16 UTSW 9 18497830 missense probably damaging 1.00
R5982:Muc16 UTSW 9 18647146 missense unknown
R5990:Muc16 UTSW 9 18659243 missense unknown
R6024:Muc16 UTSW 9 18646671 missense unknown
R6026:Muc16 UTSW 9 18659858 missense unknown
R6028:Muc16 UTSW 9 18657176 missense unknown
R6083:Muc16 UTSW 9 18657212 missense unknown
R6089:Muc16 UTSW 9 18643252 missense unknown
R6109:Muc16 UTSW 9 18655359 missense unknown
R6127:Muc16 UTSW 9 18657878 missense unknown
R6130:Muc16 UTSW 9 18590698 missense probably damaging 1.00
R6146:Muc16 UTSW 9 18497797 missense probably damaging 0.98
R6161:Muc16 UTSW 9 18647818 missense unknown
R6164:Muc16 UTSW 9 18558379 missense probably damaging 1.00
R6185:Muc16 UTSW 9 18654473 missense unknown
R6192:Muc16 UTSW 9 18658689 missense unknown
R6217:Muc16 UTSW 9 18655446 missense unknown
R6232:Muc16 UTSW 9 18656998 missense unknown
R6246:Muc16 UTSW 9 18577067 splice site probably null
R6255:Muc16 UTSW 9 18655599 missense unknown
R6280:Muc16 UTSW 9 18579317 critical splice donor site probably null
R6286:Muc16 UTSW 9 18644389 missense unknown
R6287:Muc16 UTSW 9 18659034 missense unknown
R6307:Muc16 UTSW 9 18647588 missense unknown
R6310:Muc16 UTSW 9 18641950 missense probably benign 0.00
R6316:Muc16 UTSW 9 18641819 missense probably benign 0.01
R6335:Muc16 UTSW 9 18660708 missense unknown
R6345:Muc16 UTSW 9 18654926 missense unknown
R6349:Muc16 UTSW 9 18657329 missense unknown
R6366:Muc16 UTSW 9 18646044 missense unknown
R6393:Muc16 UTSW 9 18647399 nonsense probably null
R6440:Muc16 UTSW 9 18641359 missense probably benign 0.01
R6458:Muc16 UTSW 9 18641721 missense probably benign 0.01
R6460:Muc16 UTSW 9 18640516 missense probably benign 0.01
R6481:Muc16 UTSW 9 18550677 critical splice donor site probably null
R6539:Muc16 UTSW 9 18637325 missense probably benign 0.25
R6551:Muc16 UTSW 9 18562562 missense possibly damaging 0.95
R6596:Muc16 UTSW 9 18566715 missense probably benign 0.18
R6601:Muc16 UTSW 9 18637570 missense probably benign 0.10
R6602:Muc16 UTSW 9 18609476 splice site probably null
R6615:Muc16 UTSW 9 18647188 missense unknown
R6625:Muc16 UTSW 9 18660278 missense unknown
R6668:Muc16 UTSW 9 18640385 missense probably benign 0.03
R6697:Muc16 UTSW 9 18641291 missense probably benign 0.01
R6710:Muc16 UTSW 9 18642070 missense possibly damaging 0.95
R6727:Muc16 UTSW 9 18566690 critical splice donor site probably null
R6789:Muc16 UTSW 9 18559986 missense probably benign 0.40
R6806:Muc16 UTSW 9 18537910 critical splice donor site probably null
R6874:Muc16 UTSW 9 18658769 nonsense probably null
R6894:Muc16 UTSW 9 18495576 missense possibly damaging 0.92
R6913:Muc16 UTSW 9 18642663 missense unknown
R6919:Muc16 UTSW 9 18660299 missense unknown
R6939:Muc16 UTSW 9 18638537 missense probably benign 0.04
R6956:Muc16 UTSW 9 18645026 missense unknown
R6977:Muc16 UTSW 9 18645337 missense unknown
R6996:Muc16 UTSW 9 18645897 missense unknown
R7011:Muc16 UTSW 9 18637451 missense probably benign 0.26
R7011:Muc16 UTSW 9 18637543 missense probably benign 0.10
R7012:Muc16 UTSW 9 18495618 critical splice acceptor site probably null
R7014:Muc16 UTSW 9 18658236 missense unknown
R7021:Muc16 UTSW 9 18554919 missense unknown
R7021:Muc16 UTSW 9 18550831 splice site probably null
R7038:Muc16 UTSW 9 18620468 missense probably damaging 0.99
R7057:Muc16 UTSW 9 18646079 missense unknown
R7058:Muc16 UTSW 9 18639755 missense probably benign 0.10
R7066:Muc16 UTSW 9 18658021 missense unknown
R7067:Muc16 UTSW 9 18658251 missense unknown
R7070:Muc16 UTSW 9 18645923 nonsense probably null
R7074:Muc16 UTSW 9 18655650 missense unknown
R7085:Muc16 UTSW 9 18644849 missense unknown
R7088:Muc16 UTSW 9 18592680 missense probably damaging 0.99
R7107:Muc16 UTSW 9 18637298 missense probably benign 0.10
R7108:Muc16 UTSW 9 18655233 missense unknown
R7126:Muc16 UTSW 9 18641216 missense probably benign 0.01
R7128:Muc16 UTSW 9 18643004 missense unknown
R7145:Muc16 UTSW 9 18655580 missense unknown
R7179:Muc16 UTSW 9 18642008 missense probably benign 0.00
R7194:Muc16 UTSW 9 18674454 missense unknown
R7211:Muc16 UTSW 9 18498570 missense probably damaging 1.00
R7213:Muc16 UTSW 9 18641416 missense probably benign 0.01
R7217:Muc16 UTSW 9 18644076 nonsense probably null
R7221:Muc16 UTSW 9 18642199 missense probably benign 0.04
R7265:Muc16 UTSW 9 18656472 missense unknown
R7326:Muc16 UTSW 9 18585013 missense probably benign 0.03
R7359:Muc16 UTSW 9 18643020 missense unknown
R7387:Muc16 UTSW 9 18641720 missense probably benign 0.01
R7391:Muc16 UTSW 9 18639536 missense probably benign 0.04
R7398:Muc16 UTSW 9 18637742 missense possibly damaging 0.46
R7419:Muc16 UTSW 9 18641962 missense probably benign 0.01
R7431:Muc16 UTSW 9 18607993 missense
R7484:Muc16 UTSW 9 18646768 missense unknown
R7487:Muc16 UTSW 9 18584799 missense possibly damaging 0.93
R7497:Muc16 UTSW 9 18645089 missense unknown
R7515:Muc16 UTSW 9 18639662 missense probably benign 0.00
R7537:Muc16 UTSW 9 18638135 missense probably benign 0.06
R7538:Muc16 UTSW 9 18642131 missense probably benign 0.10
R7538:Muc16 UTSW 9 18655451 missense unknown
R7543:Muc16 UTSW 9 18644732 missense unknown
R7566:Muc16 UTSW 9 18638629 missense probably benign 0.00
R7581:Muc16 UTSW 9 18645614 missense unknown
R7594:Muc16 UTSW 9 18645062 missense unknown
R7629:Muc16 UTSW 9 18566785 missense possibly damaging 0.86
R7664:Muc16 UTSW 9 18607722 missense probably benign 0.08
R7666:Muc16 UTSW 9 18558427 missense probably damaging 1.00
R7703:Muc16 UTSW 9 18605282 missense
R7727:Muc16 UTSW 9 18660242 missense unknown
R7743:Muc16 UTSW 9 18657477 missense unknown
R7744:Muc16 UTSW 9 18585096 critical splice acceptor site probably null
R7761:Muc16 UTSW 9 18580574 missense probably damaging 1.00
R7769:Muc16 UTSW 9 18660507 missense unknown
R7805:Muc16 UTSW 9 18638493 missense possibly damaging 0.94
R7827:Muc16 UTSW 9 18595223 missense possibly damaging 0.83
R7845:Muc16 UTSW 9 18640773 missense probably benign 0.01
R7849:Muc16 UTSW 9 18640505 missense probably benign 0.01
R7884:Muc16 UTSW 9 18642694 missense unknown
R7885:Muc16 UTSW 9 18639464 missense probably benign 0.10
R7886:Muc16 UTSW 9 18585982 missense probably benign 0.03
R7899:Muc16 UTSW 9 18640697 missense probably benign 0.01
R7904:Muc16 UTSW 9 18655650 missense unknown
R7921:Muc16 UTSW 9 18659318 missense unknown
R7922:Muc16 UTSW 9 18584825 missense probably benign 0.16
R7948:Muc16 UTSW 9 18642490 missense unknown
R7957:Muc16 UTSW 9 18643471 missense unknown
R7972:Muc16 UTSW 9 18645764 nonsense probably null
R7992:Muc16 UTSW 9 18656429 missense unknown
R7998:Muc16 UTSW 9 18639892 missense probably benign 0.04
R8014:Muc16 UTSW 9 18654875 missense unknown
R8033:Muc16 UTSW 9 18636606 missense probably benign 0.26
R8052:Muc16 UTSW 9 18659051 missense unknown
R8058:Muc16 UTSW 9 18660002 nonsense probably null
R8088:Muc16 UTSW 9 18519300 nonsense probably null
R8095:Muc16 UTSW 9 18584830 nonsense probably null
R8111:Muc16 UTSW 9 18592629 missense possibly damaging 0.55
R8116:Muc16 UTSW 9 18658737 missense unknown
R8117:Muc16 UTSW 9 18508910 nonsense probably null
R8137:Muc16 UTSW 9 18645676 missense unknown
R8196:Muc16 UTSW 9 18645334 missense unknown
R8218:Muc16 UTSW 9 18637019 missense possibly damaging 0.48
R8285:Muc16 UTSW 9 18642977 missense unknown
R8313:Muc16 UTSW 9 18525147 missense possibly damaging 0.85
R8317:Muc16 UTSW 9 18658043 missense unknown
R8342:Muc16 UTSW 9 18658685 missense unknown
R8351:Muc16 UTSW 9 18659885 missense unknown
R8356:Muc16 UTSW 9 18658778 missense unknown
R8360:Muc16 UTSW 9 18525258 missense probably benign 0.01
R8418:Muc16 UTSW 9 18519630 missense possibly damaging 0.94
R8420:Muc16 UTSW 9 18537511 missense probably damaging 0.99
R8437:Muc16 UTSW 9 18657924 missense unknown
R8463:Muc16 UTSW 9 18659139 missense unknown
R8466:Muc16 UTSW 9 18643148 missense unknown
R8512:Muc16 UTSW 9 18638192 missense probably benign 0.01
R8518:Muc16 UTSW 9 18519631 missense probably benign 0.12
R8556:Muc16 UTSW 9 18640937 missense probably benign 0.01
R8679:Muc16 UTSW 9 18646448 missense unknown
R8680:Muc16 UTSW 9 18644719 missense unknown
R8720:Muc16 UTSW 9 18641600 missense probably benign 0.01
R8729:Muc16 UTSW 9 18660050 missense unknown
R8736:Muc16 UTSW 9 18550843 nonsense probably null
R8739:Muc16 UTSW 9 18637298 missense probably benign 0.10
R8807:Muc16 UTSW 9 18656057 missense unknown
R8830:Muc16 UTSW 9 18646069 missense unknown
R8871:Muc16 UTSW 9 18656048 missense unknown
R8884:Muc16 UTSW 9 18644200 missense unknown
R8923:Muc16 UTSW 9 18638676 missense probably benign 0.01
R8948:Muc16 UTSW 9 18647233 missense unknown
R8949:Muc16 UTSW 9 18520925 critical splice donor site probably null
R8987:Muc16 UTSW 9 18551685 nonsense probably null
R8997:Muc16 UTSW 9 18607467 intron probably benign
R9013:Muc16 UTSW 9 18512773 missense possibly damaging 0.94
R9020:Muc16 UTSW 9 18638719 small insertion probably benign
R9036:Muc16 UTSW 9 18644679 missense unknown
R9040:Muc16 UTSW 9 18644786 nonsense probably null
R9065:Muc16 UTSW 9 18643009 missense unknown
R9089:Muc16 UTSW 9 18644550 missense unknown
R9098:Muc16 UTSW 9 18643679 missense unknown
R9100:Muc16 UTSW 9 18645670 missense unknown
R9128:Muc16 UTSW 9 18647582 missense unknown
R9169:Muc16 UTSW 9 18656528 missense unknown
R9180:Muc16 UTSW 9 18642742 missense unknown
R9191:Muc16 UTSW 9 18644810 missense unknown
R9203:Muc16 UTSW 9 18551688 missense unknown
R9208:Muc16 UTSW 9 18508537 missense probably damaging 0.99
R9232:Muc16 UTSW 9 18656040 missense unknown
R9240:Muc16 UTSW 9 18538013 missense unknown
R9254:Muc16 UTSW 9 18646171 missense unknown
R9330:Muc16 UTSW 9 18641036 missense probably benign 0.04
R9347:Muc16 UTSW 9 18660215 missense unknown
R9358:Muc16 UTSW 9 18642224 missense probably benign 0.01
R9359:Muc16 UTSW 9 18537764 critical splice donor site probably null
R9379:Muc16 UTSW 9 18646171 missense unknown
R9403:Muc16 UTSW 9 18537764 critical splice donor site probably null
R9422:Muc16 UTSW 9 18641806 missense probably benign 0.01
R9433:Muc16 UTSW 9 18572641 missense probably benign 0.09
R9438:Muc16 UTSW 9 18647732 missense unknown
R9442:Muc16 UTSW 9 18655328 missense unknown
R9453:Muc16 UTSW 9 18660765 missense unknown
R9467:Muc16 UTSW 9 18597035 missense probably benign 0.03
R9490:Muc16 UTSW 9 18656853 nonsense probably null
R9519:Muc16 UTSW 9 18586920 missense probably benign 0.03
R9524:Muc16 UTSW 9 18586018 missense probably benign 0.03
R9556:Muc16 UTSW 9 18658638 missense unknown
R9583:Muc16 UTSW 9 18638677 missense probably benign 0.01
R9600:Muc16 UTSW 9 18655851 missense unknown
R9638:Muc16 UTSW 9 18639330 missense probably benign 0.12
R9650:Muc16 UTSW 9 18642466 missense unknown
R9652:Muc16 UTSW 9 18586882 missense probably benign 0.03
R9666:Muc16 UTSW 9 18655989 missense unknown
R9682:Muc16 UTSW 9 18642578 missense unknown
R9765:Muc16 UTSW 9 18637198 missense probably benign 0.16
R9766:Muc16 UTSW 9 18636857 missense probably benign 0.08
R9766:Muc16 UTSW 9 18641087 missense probably benign 0.01
R9776:Muc16 UTSW 9 18659379 missense unknown
R9782:Muc16 UTSW 9 18636770 missense possibly damaging 0.64
Z1177:Muc16 UTSW 9 18537571 missense probably benign 0.26
Z1177:Muc16 UTSW 9 18657861 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGAGACACCATAGGTAGACCC -3'
(R):5'- GGTGTTCCACAAATGATGACAG -3'

Sequencing Primer
(F):5'- GGTAGACCCAGATAAACTTGACTCTC -3'
(R):5'- TTCCAATAGTCACACACATTCCTGGG -3'
Posted On 2018-11-28