Incidental Mutation 'R6953:Abcc3'
ID541324
Institutional Source Beutler Lab
Gene Symbol Abcc3
Ensembl Gene ENSMUSG00000020865
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 3
SynonymsMRP3, 1700019L09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6953 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location94343295-94392997 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94374835 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 125 (Y125H)
Ref Sequence ENSEMBL: ENSMUSP00000136343 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021231] [ENSMUST00000178136]
Predicted Effect probably benign
Transcript: ENSMUST00000021231
AA Change: Y125H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000021231
Gene: ENSMUSG00000020865
AA Change: Y125H

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
transmembrane domain 64 86 N/A INTRINSIC
transmembrane domain 101 123 N/A INTRINSIC
transmembrane domain 130 152 N/A INTRINSIC
transmembrane domain 172 190 N/A INTRINSIC
Pfam:ABC_membrane 310 581 4.4e-43 PFAM
AAA 652 827 2.77e-10 SMART
Pfam:ABC_membrane 963 1235 3.2e-46 PFAM
AAA 1310 1495 2.66e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178136
AA Change: Y125H

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000136343
Gene: ENSMUSG00000020865
AA Change: Y125H

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
transmembrane domain 64 86 N/A INTRINSIC
transmembrane domain 101 123 N/A INTRINSIC
transmembrane domain 130 152 N/A INTRINSIC
transmembrane domain 172 190 N/A INTRINSIC
Pfam:ABC_membrane 310 581 4.8e-34 PFAM
AAA 652 827 2.77e-10 SMART
coiled coil region 854 883 N/A INTRINSIC
Pfam:ABC_membrane 967 1236 8.6e-48 PFAM
AAA 1311 1496 2.66e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The specific function of this protein has not yet been determined; however, this protein may play a role in the transport of biliary and intestinal excretion of organic anions. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene exhibit increased liver bile acid levels after bile duct ligation [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik C A 15: 58,028,827 S128I probably damaging Het
Aadacl2 A C 3: 60,024,760 H232P possibly damaging Het
Adgrb3 A G 1: 25,826,511 S84P probably damaging Het
Adgrd1 A T 5: 129,115,078 K71* probably null Het
Ap2m1 T A 16: 20,542,718 W381R probably damaging Het
Ascc3 A G 10: 50,645,666 I426V probably benign Het
BC024063 T A 10: 82,107,899 D31E possibly damaging Het
C3ar1 G A 6: 122,850,632 H209Y possibly damaging Het
Ccp110 T C 7: 118,722,421 V433A possibly damaging Het
Cfap54 A G 10: 92,994,678 S1199P probably benign Het
Cyp24a1 T G 2: 170,487,946 D362A probably benign Het
Dapk2 C G 9: 66,254,622 R271G probably benign Het
Dnmt1 G T 9: 20,918,526 Q633K probably benign Het
Ercc4 T A 16: 13,130,686 V499D probably damaging Het
Ier3ip1 C G 18: 76,939,613 P46R probably damaging Het
Ifi211 T C 1: 173,906,266 T110A probably damaging Het
Isoc1 A G 18: 58,671,302 D134G possibly damaging Het
Kif26b A G 1: 178,874,072 D672G possibly damaging Het
Klhl33 T A 14: 50,891,516 D752V possibly damaging Het
Lcn4 A G 2: 26,669,355 Y133H probably benign Het
Mrs2 C A 13: 25,001,788 V134L probably benign Het
Muc16 T C 9: 18,640,529 T4823A probably benign Het
Ogfod3 A G 11: 121,202,998 I62T probably benign Het
Olfr1380 A G 11: 49,564,290 Y123C probably damaging Het
Olfr165 C T 16: 19,407,528 V164I probably benign Het
Olfr773 A T 10: 129,186,605 M272K probably benign Het
Olfr869 A T 9: 20,138,003 I296L probably benign Het
Papln G A 12: 83,781,885 W788* probably null Het
Pcdhac2 A G 18: 37,144,426 Q153R probably benign Het
Pcdhgb2 C T 18: 37,690,754 T266I possibly damaging Het
Pcdhgc5 C A 18: 37,820,461 R263S possibly damaging Het
Phactr4 T C 4: 132,377,351 T185A possibly damaging Het
Plcxd2 T C 16: 45,980,519 D114G probably damaging Het
Polr2a A T 11: 69,741,711 I987N probably damaging Het
Prl3d3 A G 13: 27,161,046 M134V probably benign Het
Pum2 T A 12: 8,728,779 probably null Het
Racgap1 T C 15: 99,626,329 E399G probably damaging Het
Sbspon A T 1: 15,860,295 S156T probably damaging Het
Scn1a T C 2: 66,319,469 T927A probably damaging Het
Sec23ip C A 7: 128,752,796 S78* probably null Het
Serpina1d G A 12: 103,767,730 T105I probably benign Het
Slc25a21 T A 12: 57,159,169 N26Y probably benign Het
Smim20 T A 5: 53,277,916 D64E probably damaging Het
Spag17 T G 3: 100,034,975 I772S possibly damaging Het
Tars2 T C 3: 95,753,114 T99A possibly damaging Het
Tdrd1 C T 19: 56,831,371 T101I probably damaging Het
Tldc2 T G 2: 157,089,278 probably null Het
Ttn A G 2: 76,771,585 Y10251H probably damaging Het
Ush2a A G 1: 188,263,145 R38G possibly damaging Het
Usp19 T C 9: 108,498,931 L991P possibly damaging Het
Vmn2r109 G A 17: 20,540,711 P795S possibly damaging Het
Vmn2r26 T C 6: 124,039,782 Y402H probably benign Het
Vmn2r-ps117 T G 17: 18,824,833 I504R probably benign Het
Zfp551 A T 7: 12,416,788 C231* probably null Het
Zfp607a T A 7: 27,878,365 C287S possibly damaging Het
Zim1 T A 7: 6,687,707 T40S unknown Het
Other mutations in Abcc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:Abcc3 APN 11 94343785 splice site probably benign
IGL01154:Abcc3 APN 11 94359232 splice site probably benign
IGL01353:Abcc3 APN 11 94352108 missense possibly damaging 0.88
IGL02553:Abcc3 APN 11 94351924 missense probably damaging 1.00
IGL02795:Abcc3 APN 11 94361642 splice site probably benign
IGL02928:Abcc3 APN 11 94361306 missense possibly damaging 0.49
IGL02964:Abcc3 APN 11 94351810 missense possibly damaging 0.93
IGL03006:Abcc3 APN 11 94368595 missense probably benign 0.18
IGL03345:Abcc3 APN 11 94359337 missense probably damaging 1.00
R0200:Abcc3 UTSW 11 94355074 missense probably damaging 0.96
R0377:Abcc3 UTSW 11 94375096 missense possibly damaging 0.90
R0812:Abcc3 UTSW 11 94375202 splice site probably benign
R1269:Abcc3 UTSW 11 94357384 missense probably damaging 1.00
R1270:Abcc3 UTSW 11 94357384 missense probably damaging 1.00
R1375:Abcc3 UTSW 11 94352216 missense possibly damaging 0.46
R1506:Abcc3 UTSW 11 94357318 missense possibly damaging 0.89
R1525:Abcc3 UTSW 11 94361236 missense probably benign 0.00
R1842:Abcc3 UTSW 11 94359612 missense probably benign 0.00
R1868:Abcc3 UTSW 11 94364063 missense probably benign 0.06
R2069:Abcc3 UTSW 11 94364417 missense probably damaging 1.00
R2132:Abcc3 UTSW 11 94367600 missense probably benign 0.18
R2257:Abcc3 UTSW 11 94363594 missense probably damaging 1.00
R2395:Abcc3 UTSW 11 94357306 missense possibly damaging 0.90
R2930:Abcc3 UTSW 11 94361810 missense probably damaging 0.99
R3081:Abcc3 UTSW 11 94356976 missense probably damaging 1.00
R3824:Abcc3 UTSW 11 94368620 critical splice acceptor site probably null
R4385:Abcc3 UTSW 11 94368239 missense probably damaging 0.99
R4425:Abcc3 UTSW 11 94346044 missense probably damaging 0.98
R4464:Abcc3 UTSW 11 94358786 missense probably benign 0.01
R4696:Abcc3 UTSW 11 94350991 missense probably benign 0.01
R4877:Abcc3 UTSW 11 94367595 missense probably damaging 0.98
R5172:Abcc3 UTSW 11 94375608 missense probably damaging 1.00
R5586:Abcc3 UTSW 11 94364421 missense probably damaging 1.00
R5682:Abcc3 UTSW 11 94392897 missense probably benign 0.31
R5719:Abcc3 UTSW 11 94351068 missense probably damaging 1.00
R5816:Abcc3 UTSW 11 94343737 missense probably damaging 0.99
R5919:Abcc3 UTSW 11 94357306 missense possibly damaging 0.90
R6222:Abcc3 UTSW 11 94368605 missense probably benign 0.21
R6264:Abcc3 UTSW 11 94373998 missense probably damaging 0.99
R6526:Abcc3 UTSW 11 94359372 missense probably benign 0.21
R6782:Abcc3 UTSW 11 94358950 missense probably damaging 1.00
R6889:Abcc3 UTSW 11 94375555 missense possibly damaging 0.49
R7054:Abcc3 UTSW 11 94365225 missense probably benign 0.01
R7131:Abcc3 UTSW 11 94365031 missense probably damaging 1.00
R7210:Abcc3 UTSW 11 94373941 missense probably benign 0.03
R7283:Abcc3 UTSW 11 94357047 missense probably benign 0.44
R7284:Abcc3 UTSW 11 94357047 missense probably benign 0.44
R7285:Abcc3 UTSW 11 94357047 missense probably benign 0.44
R7287:Abcc3 UTSW 11 94357047 missense probably benign 0.44
R7320:Abcc3 UTSW 11 94367645 missense probably benign 0.33
R7450:Abcc3 UTSW 11 94361695 missense probably damaging 1.00
R7469:Abcc3 UTSW 11 94368188 missense probably damaging 1.00
R7794:Abcc3 UTSW 11 94358871 missense probably benign 0.12
R7851:Abcc3 UTSW 11 94359660 nonsense probably null
R7861:Abcc3 UTSW 11 94357249 missense probably null 1.00
R7934:Abcc3 UTSW 11 94359660 nonsense probably null
R7944:Abcc3 UTSW 11 94357249 missense probably null 1.00
R8036:Abcc3 UTSW 11 94345992 missense possibly damaging 0.47
X0064:Abcc3 UTSW 11 94363498 missense probably benign 0.00
Z1176:Abcc3 UTSW 11 94361275 missense probably benign 0.01
Z1177:Abcc3 UTSW 11 94357008 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCTGAACAGAGGAAACCC -3'
(R):5'- CTACGACCATGGACTCTGAAG -3'

Sequencing Primer
(F):5'- AGCAGTAACCTTGAGCCTTG -3'
(R):5'- TCTGAAGAAGAGGGTGGACACATG -3'
Posted On2018-11-28