Mutagenetix > Incidental Mutation

Incidental Mutation 'R6953:Vmn2r109'

541340

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r109

Ensembl Gene

ENSMUSG00000090572

Gene Name

vomeronasal 2, receptor 109

Synonyms

EG627814

MMRRC Submission

045065-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.091) question?

Stock #

R6953 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

20540517-20564756 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 20540711 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 795 (P795S)

Ref Sequence

ENSEMBL: ENSMUSP00000132641 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000167093]

AlphaFold

K7N747

Predicted Effect

possibly damaging
Transcript: ENSMUST00000167093
AA Change: P795S

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000132641
Gene: ENSMUSG00000090572
AA Change: P795S

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:ANF_receptor	83	467	1.4e-35	PFAM
Pfam:NCD3G	510	563	3.1e-21	PFAM
Pfam:7tm_3	596	831	7.4e-52	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.3%

Validation Efficiency

98% (54/55)

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130401M01Rik	C	A	15: 58,028,827	S128I	probably damaging	Het
Aadacl2	A	C	3: 60,024,760	H232P	possibly damaging	Het
Abcc3	A	G	11: 94,374,835	Y125H	probably benign	Het
Adgrb3	A	G	1: 25,826,511	S84P	probably damaging	Het
Adgrd1	A	T	5: 129,115,078	K71*	probably null	Het
Ap2m1	T	A	16: 20,542,718	W381R	probably damaging	Het
Ascc3	A	G	10: 50,645,666	I426V	probably benign	Het
BC024063	T	A	10: 82,107,899	D31E	possibly damaging	Het
C3ar1	G	A	6: 122,850,632	H209Y	possibly damaging	Het
Ccp110	T	C	7: 118,722,421	V433A	possibly damaging	Het
Cfap54	A	G	10: 92,994,678	S1199P	probably benign	Het
Cyp24a1	T	G	2: 170,487,946	D362A	probably benign	Het
Dapk2	C	G	9: 66,254,622	R271G	probably benign	Het
Dnmt1	G	T	9: 20,918,526	Q633K	probably benign	Het
Ercc4	T	A	16: 13,130,686	V499D	probably damaging	Het
Ier3ip1	C	G	18: 76,939,613	P46R	probably damaging	Het
Ifi211	T	C	1: 173,906,266	T110A	probably damaging	Het
Isoc1	A	G	18: 58,671,302	D134G	possibly damaging	Het
Kif26b	A	G	1: 178,874,072	D672G	possibly damaging	Het
Klhl33	T	A	14: 50,891,516	D752V	possibly damaging	Het
Lcn4	A	G	2: 26,669,355	Y133H	probably benign	Het
Mrs2	C	A	13: 25,001,788	V134L	probably benign	Het
Muc16	T	C	9: 18,640,529	T4823A	probably benign	Het
Ogfod3	A	G	11: 121,202,998	I62T	probably benign	Het
Olfr1380	A	G	11: 49,564,290	Y123C	probably damaging	Het
Olfr165	C	T	16: 19,407,528	V164I	probably benign	Het
Olfr773	A	T	10: 129,186,605	M272K	probably benign	Het
Olfr869	A	T	9: 20,138,003	I296L	probably benign	Het
Papln	G	A	12: 83,781,885	W788*	probably null	Het
Pcdhac2	A	G	18: 37,144,426	Q153R	probably benign	Het
Pcdhgb2	C	T	18: 37,690,754	T266I	possibly damaging	Het
Pcdhgc5	C	A	18: 37,820,461	R263S	possibly damaging	Het
Phactr4	T	C	4: 132,377,351	T185A	possibly damaging	Het
Plcxd2	T	C	16: 45,980,519	D114G	probably damaging	Het
Polr2a	A	T	11: 69,741,711	I987N	probably damaging	Het
Prl3d3	A	G	13: 27,161,046	M134V	probably benign	Het
Pum2	T	A	12: 8,728,779		probably null	Het
Racgap1	T	C	15: 99,626,329	E399G	probably damaging	Het
Sbspon	A	T	1: 15,860,295	S156T	probably damaging	Het
Scn1a	T	C	2: 66,319,469	T927A	probably damaging	Het
Sec23ip	C	A	7: 128,752,796	S78*	probably null	Het
Serpina1d	G	A	12: 103,767,730	T105I	probably benign	Het
Slc25a21	T	A	12: 57,159,169	N26Y	probably benign	Het
Smim20	T	A	5: 53,277,916	D64E	probably damaging	Het
Spag17	T	G	3: 100,034,975	I772S	possibly damaging	Het
Tars2	T	C	3: 95,753,114	T99A	possibly damaging	Het
Tdrd1	C	T	19: 56,831,371	T101I	probably damaging	Het
Tldc2	T	G	2: 157,089,278		probably null	Het
Ttn	A	G	2: 76,771,585	Y10251H	probably damaging	Het
Ush2a	A	G	1: 188,263,145	R38G	possibly damaging	Het
Usp19	T	C	9: 108,498,931	L991P	possibly damaging	Het
Vmn2r26	T	C	6: 124,039,782	Y402H	probably benign	Het
Vmn2r-ps117	T	G	17: 18,824,833	I504R	probably benign	Het
Zfp551	A	T	7: 12,416,788	C231*	probably null	Het
Zfp607a	T	A	7: 27,878,365	C287S	possibly damaging	Het
Zim1	T	A	7: 6,687,707	T40S	unknown	Het

Other mutations in Vmn2r109

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01313:Vmn2r109	APN	17	20550157	missense	probably damaging	1.00
IGL01383:Vmn2r109	APN	17	20541121	missense	possibly damaging	0.89
IGL01469:Vmn2r109	APN	17	20541409	missense	probably damaging	1.00
IGL01762:Vmn2r109	APN	17	20554392	missense	probably benign
IGL01864:Vmn2r109	APN	17	20541134	missense	probably benign	0.28
IGL02028:Vmn2r109	APN	17	20541080	missense	probably benign	0.28
IGL02074:Vmn2r109	APN	17	20554341	missense	probably benign	0.05
IGL02162:Vmn2r109	APN	17	20554160	missense	probably benign	0.01
IGL02474:Vmn2r109	APN	17	20540888	missense	probably benign
IGL02490:Vmn2r109	APN	17	20540984	missense	possibly damaging	0.78
IGL02604:Vmn2r109	APN	17	20540701	missense	probably damaging	1.00
IGL02669:Vmn2r109	APN	17	20554256	missense	possibly damaging	0.64
IGL02705:Vmn2r109	APN	17	20553800	missense	probably benign
IGL02745:Vmn2r109	APN	17	20541250	missense	probably damaging	0.99
PIT4142001:Vmn2r109	UTSW	17	20554577	critical splice acceptor site	probably null
R0389:Vmn2r109	UTSW	17	20541074	missense	probably damaging	1.00
R0470:Vmn2r109	UTSW	17	20552886	missense	probably benign	0.06
R0570:Vmn2r109	UTSW	17	20540675	missense	probably damaging	0.99
R0855:Vmn2r109	UTSW	17	20541408	nonsense	probably null
R0882:Vmn2r109	UTSW	17	20554580	splice site	probably benign
R1241:Vmn2r109	UTSW	17	20555241	missense	possibly damaging	0.86
R1587:Vmn2r109	UTSW	17	20540740	missense	probably damaging	1.00
R1931:Vmn2r109	UTSW	17	20553810	nonsense	probably null
R1957:Vmn2r109	UTSW	17	20564707	missense	probably benign	0.11
R1962:Vmn2r109	UTSW	17	20553923	missense	probably damaging	0.99
R2020:Vmn2r109	UTSW	17	20541186	nonsense	probably null
R2073:Vmn2r109	UTSW	17	20564712	missense	probably benign	0.00
R2436:Vmn2r109	UTSW	17	20554536	missense	probably damaging	0.99
R3123:Vmn2r109	UTSW	17	20540986	missense	probably damaging	1.00
R3839:Vmn2r109	UTSW	17	20554442	missense	probably damaging	1.00
R4019:Vmn2r109	UTSW	17	20553812	missense	probably benign
R4428:Vmn2r109	UTSW	17	20553024	missense	probably benign
R4584:Vmn2r109	UTSW	17	20554558	nonsense	probably null
R4652:Vmn2r109	UTSW	17	20541394	missense	probably damaging	1.00
R4708:Vmn2r109	UTSW	17	20541343	missense	probably damaging	0.97
R4823:Vmn2r109	UTSW	17	20553891	missense	probably damaging	1.00
R4831:Vmn2r109	UTSW	17	20541232	missense	probably benign	0.01
R4907:Vmn2r109	UTSW	17	20550086	missense	probably damaging	1.00
R5011:Vmn2r109	UTSW	17	20555189	missense	probably damaging	1.00
R5296:Vmn2r109	UTSW	17	20554341	missense	possibly damaging	0.90
R5600:Vmn2r109	UTSW	17	20540927	missense	probably damaging	1.00
R5602:Vmn2r109	UTSW	17	20540671	missense	possibly damaging	0.94
R5652:Vmn2r109	UTSW	17	20540519	makesense	probably null
R5702:Vmn2r109	UTSW	17	20554145	missense	probably benign	0.42
R5706:Vmn2r109	UTSW	17	20554305	missense	probably benign	0.16
R5714:Vmn2r109	UTSW	17	20552859	missense	probably damaging	1.00
R5832:Vmn2r109	UTSW	17	20541056	missense	probably benign	0.10
R6008:Vmn2r109	UTSW	17	20540719	missense	probably damaging	1.00
R6334:Vmn2r109	UTSW	17	20541178	missense	probably benign	0.18
R6377:Vmn2r109	UTSW	17	20564534	critical splice donor site	probably null
R6738:Vmn2r109	UTSW	17	20554523	missense	possibly damaging	0.52
R6857:Vmn2r109	UTSW	17	20540670	missense	probably benign	0.45
R7108:Vmn2r109	UTSW	17	20564744	missense	probably benign	0.03
R7229:Vmn2r109	UTSW	17	20540963	missense	possibly damaging	0.80
R7238:Vmn2r109	UTSW	17	20541074	missense	probably damaging	1.00
R7244:Vmn2r109	UTSW	17	20540683	missense	possibly damaging	0.70
R7292:Vmn2r109	UTSW	17	20541438	missense	probably benign	0.05
R7354:Vmn2r109	UTSW	17	20540781	missense	probably damaging	1.00
R7357:Vmn2r109	UTSW	17	20541274	missense	probably damaging	1.00
R7522:Vmn2r109	UTSW	17	20554403	missense	probably benign	0.11
R7596:Vmn2r109	UTSW	17	20540680	missense	probably damaging	0.98
R7728:Vmn2r109	UTSW	17	20552855	missense	probably damaging	0.99
R7859:Vmn2r109	UTSW	17	20541174	missense	probably damaging	1.00
R7871:Vmn2r109	UTSW	17	20540520	missense	probably benign	0.08
R8113:Vmn2r109	UTSW	17	20554467	missense	probably benign	0.01
R8153:Vmn2r109	UTSW	17	20564707	missense	probably benign	0.11
R8977:Vmn2r109	UTSW	17	20554269	missense	possibly damaging	0.96
R9687:Vmn2r109	UTSW	17	20555070	missense
Z1176:Vmn2r109	UTSW	17	20552994	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TTCAGGTTTGATGCCACCAATTC -3'
(R):5'- AGGGATCATCTGTTGCCTTCC -3'

Sequencing Primer
(F):5'- GGTTTGATGCCACCAATTCATAGAC -3'
(R):5'- TTCCACTGTGTTCTGGGATAC -3'

Posted On

2018-11-28