Mutagenetix > Incidental Mutation

Incidental Mutation 'R6954:Pik3c2b'

541349

Institutional Source

Beutler Lab

Gene Symbol

Pik3c2b

Ensembl Gene

ENSMUSG00000026447

Gene Name

phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta

Synonyms

C330011J12Rik, PI3K-C2beta

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.251) question?

Stock #

R6954 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

133045667-133108687 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 133066303 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Alanine at position 2 (S2A)

Ref Sequence

ENSEMBL: ENSMUSP00000115469 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077730] [ENSMUST00000153707]

AlphaFold

E9QAN8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000077730
AA Change: S2A

PolyPhen 2 Score 0.501 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000076911
Gene: ENSMUSG00000026447
AA Change: S2A

Domain	Start	End	E-Value	Type
low complexity region	155	160	N/A	INTRINSIC
low complexity region	168	183	N/A	INTRINSIC
PI3K_rbd	363	465	2.15e-19	SMART
PI3K_C2	618	726	6.17e-29	SMART
PI3Ka	804	990	1.66e-84	SMART
PI3Kc	1078	1340	3.45e-132	SMART
PX	1364	1476	9.44e-27	SMART
low complexity region	1481	1492	N/A	INTRINSIC
C2	1517	1622	1.82e-18	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000153707
AA Change: S2A

PolyPhen 2 Score 0.501 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000115469
Gene: ENSMUSG00000026447
AA Change: S2A

Domain	Start	End	E-Value	Type
low complexity region	155	160	N/A	INTRINSIC
low complexity region	168	183	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.5%

Validation Efficiency

98% (57/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is sensitive to low nanomolar levels of the inhibitor wortmanin. The C2 domain of this protein was shown to bind phospholipids but not Ca2+, which suggests that this enzyme may function in a calcium-independent manner. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal epidermal growth, differentiation and function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210407C18Rik	T	A	11: 58,608,488	Y168F	probably benign	Het
4930451I11Rik	A	T	7: 126,830,637		probably null	Het
Alox5	A	C	6: 116,420,280	Y314*	probably null	Het
Ap4e1	T	C	2: 127,064,951	S1044P	probably benign	Het
Ash2l	A	G	8: 25,822,768	V391A	possibly damaging	Het
B4galnt4	A	G	7: 141,067,232	T326A	probably benign	Het
Ccm2	T	A	11: 6,594,239	I345N	probably damaging	Het
Cntnap3	G	A	13: 64,748,559	H1034Y	probably benign	Het
Cpsf1	A	G	15: 76,599,496	L849S	probably damaging	Het
Ctrb1	A	G	8: 111,686,664	S239P	probably damaging	Het
D13Ertd608e	A	G	13: 119,846,130	D20G	possibly damaging	Het
Dennd1b	T	A	1: 139,168,945		probably benign	Het
Dnah17	A	G	11: 118,066,432	I2773T	probably damaging	Het
Eif2b2	T	A	12: 85,226,043	F267L	probably damaging	Het
Fcrls	A	G	3: 87,263,676		probably benign	Het
Furin	G	T	7: 80,396,964	D181E	possibly damaging	Het
Gm29106	T	A	1: 118,200,587	C670S	probably damaging	Het
Gm6309	A	T	5: 146,168,490	D204E	possibly damaging	Het
Hsf2	T	A	10: 57,504,643	I191N	probably damaging	Het
Hspa12a	T	C	19: 58,799,692	D566G	probably benign	Het
Igf1	G	C	10: 87,864,860	V49L	probably damaging	Het
Igfbpl1	C	T	4: 45,826,663	C44Y	probably damaging	Het
Letm1	G	A	5: 33,782,507	R16C	probably benign	Het
Marf1	A	G	16: 14,138,520	V819A	probably damaging	Het
Mfsd4b4	A	T	10: 39,891,952	S428T	probably benign	Het
Myo1d	T	C	11: 80,674,957	I347M	probably benign	Het
Myo9b	A	G	8: 71,290,819	I175V	probably damaging	Het
Naip5	A	T	13: 100,223,414	V438E	probably damaging	Het
Nup205	T	A	6: 35,208,109	V768E	possibly damaging	Het
Olfr1015	T	A	2: 85,786,382	Y290*	probably null	Het
Olfr731	A	T	14: 50,238,110	Y258*	probably null	Het
Pcdh15	C	T	10: 74,645,989	H1651Y	possibly damaging	Het
Pdgfra	A	T	5: 75,173,394	Q376L	possibly damaging	Het
Pign	T	C	1: 105,553,897	I791M	probably benign	Het
Pip5k1a	A	T	3: 95,068,247	I304K	probably damaging	Het
Pkdrej	A	T	15: 85,817,853	L1294*	probably null	Het
Pprc1	T	C	19: 46,064,433	S797P	probably damaging	Het
Prob1	A	G	18: 35,654,268	V311A	probably benign	Het
Prune2	C	A	19: 17,000,021	T40K	probably damaging	Het
Rif1	T	G	2: 52,112,691	D2052E	probably benign	Het
Sall1	A	G	8: 89,032,891	V195A	probably damaging	Het
Scfd1	T	C	12: 51,427,946		probably null	Het
Sidt2	A	T	9: 45,952,850	N123K	probably benign	Het
Slc22a6	G	A	19: 8,622,096	A320T	probably benign	Het
Slc25a10	A	G	11: 120,498,147	H279R	probably benign	Het
Slc35b4	A	G	6: 34,158,621	V252A	probably benign	Het
Slc46a3	T	C	5: 147,886,340	T231A	probably benign	Het
Stxbp1	T	A	2: 32,801,893	H429L	probably damaging	Het
Tas2r134	C	T	2: 51,627,770	T87I	probably benign	Het
Tdpoz2	A	T	3: 93,652,275	L130H	probably damaging	Het
Tmem69	T	C	4: 116,554,724		probably null	Het
Tmppe	G	A	9: 114,405,523	V297I	probably benign	Het
Ung	G	T	5: 114,131,337	A37S	probably benign	Het
Vdac1	T	C	11: 52,386,373	Y237H	probably damaging	Het
Vgll4	T	C	6: 114,921,367	Y11C	probably damaging	Het
Vmn1r24	A	G	6: 57,956,452	I27T	probably benign	Het
Zfp280b	T	A	10: 76,039,688	M467K	probably benign	Het
Zkscan4	A	G	13: 21,484,365	I329V	probably damaging	Het

Other mutations in Pik3c2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01086:Pik3c2b	APN	1	133091618	missense	probably damaging	0.98
IGL01288:Pik3c2b	APN	1	133094805	missense	probably damaging	0.96
IGL01313:Pik3c2b	APN	1	133071631	nonsense	probably null
IGL01367:Pik3c2b	APN	1	133105988	missense	probably benign	0.02
IGL02379:Pik3c2b	APN	1	133094791	missense	probably damaging	1.00
IGL02638:Pik3c2b	APN	1	133077318	splice site	probably benign
IGL02728:Pik3c2b	APN	1	133092327	missense	probably benign	0.09
IGL02992:Pik3c2b	APN	1	133066980	nonsense	probably null
IGL03121:Pik3c2b	APN	1	133079745	missense	probably benign	0.00
R0453:Pik3c2b	UTSW	1	133077396	missense	probably damaging	1.00
R0518:Pik3c2b	UTSW	1	133105992	missense	probably damaging	1.00
R0616:Pik3c2b	UTSW	1	133100831	missense	probably damaging	1.00
R0659:Pik3c2b	UTSW	1	133071200	missense	probably damaging	0.99
R1542:Pik3c2b	UTSW	1	133090034	missense	probably damaging	1.00
R1716:Pik3c2b	UTSW	1	133094826	missense	probably damaging	1.00
R1728:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1729:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1730:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1739:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1762:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1783:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1784:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1785:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1816:Pik3c2b	UTSW	1	133101370	missense	probably benign	0.00
R1897:Pik3c2b	UTSW	1	133066916	missense	possibly damaging	0.57
R2006:Pik3c2b	UTSW	1	133066544	missense	probably damaging	1.00
R2067:Pik3c2b	UTSW	1	133099611	missense	probably damaging	1.00
R2271:Pik3c2b	UTSW	1	133103428	missense	probably benign
R2294:Pik3c2b	UTSW	1	133066775	missense	probably damaging	1.00
R2320:Pik3c2b	UTSW	1	133103413	missense	probably damaging	1.00
R4735:Pik3c2b	UTSW	1	133067049	missense	probably benign	0.25
R4926:Pik3c2b	UTSW	1	133099626	nonsense	probably null
R4948:Pik3c2b	UTSW	1	133099715	critical splice donor site	probably null
R4997:Pik3c2b	UTSW	1	133105081	missense	probably damaging	1.00
R5304:Pik3c2b	UTSW	1	133070408	missense	possibly damaging	0.50
R5461:Pik3c2b	UTSW	1	133099702	missense	possibly damaging	0.66
R5722:Pik3c2b	UTSW	1	133103836	missense	probably damaging	1.00
R5971:Pik3c2b	UTSW	1	133074627	splice site	probably null
R5980:Pik3c2b	UTSW	1	133088308	missense	probably benign	0.43
R6036:Pik3c2b	UTSW	1	133090713	missense	possibly damaging	0.95
R6138:Pik3c2b	UTSW	1	133074627	splice site	probably null
R6223:Pik3c2b	UTSW	1	133070357	missense	probably damaging	1.00
R6273:Pik3c2b	UTSW	1	133066711	missense	probably benign	0.02
R6742:Pik3c2b	UTSW	1	133075821	missense	probably benign
R6998:Pik3c2b	UTSW	1	133102372	missense	probably benign	0.23
R7103:Pik3c2b	UTSW	1	133105974	missense	probably damaging	1.00
R7133:Pik3c2b	UTSW	1	133090234	missense	possibly damaging	0.73
R7161:Pik3c2b	UTSW	1	133106112	missense	probably damaging	0.98
R7183:Pik3c2b	UTSW	1	133066465	missense	probably benign	0.00
R7193:Pik3c2b	UTSW	1	133079774	missense	probably benign	0.00
R7252:Pik3c2b	UTSW	1	133094734	missense	probably benign	0.19
R7263:Pik3c2b	UTSW	1	133090202	missense	probably damaging	0.98
R7404:Pik3c2b	UTSW	1	133090706	missense	probably damaging	1.00
R7709:Pik3c2b	UTSW	1	133079841	critical splice donor site	probably null
R7712:Pik3c2b	UTSW	1	133085611	missense	probably damaging	1.00
R7823:Pik3c2b	UTSW	1	133102305	missense	probably damaging	1.00
R7831:Pik3c2b	UTSW	1	133071242	missense	possibly damaging	0.94
R7913:Pik3c2b	UTSW	1	133090061	critical splice donor site	probably null
R7916:Pik3c2b	UTSW	1	133100904	missense	probably benign	0.30
R7960:Pik3c2b	UTSW	1	133103849	missense	probably damaging	1.00
R7981:Pik3c2b	UTSW	1	133075809	critical splice acceptor site	probably null
R8346:Pik3c2b	UTSW	1	133090246	missense	probably damaging	0.97
R8938:Pik3c2b	UTSW	1	133088330	missense	probably benign	0.19
R8997:Pik3c2b	UTSW	1	133090779	missense	possibly damaging	0.83
R9416:Pik3c2b	UTSW	1	133077449	missense	probably damaging	1.00
R9598:Pik3c2b	UTSW	1	133084987	critical splice donor site	probably null
R9621:Pik3c2b	UTSW	1	133071607	missense	probably damaging	1.00
R9742:Pik3c2b	UTSW	1	133094749	missense	probably damaging	1.00
R9776:Pik3c2b	UTSW	1	133090850	missense	possibly damaging	0.64
R9786:Pik3c2b	UTSW	1	133091600	missense	possibly damaging	0.94
U15987:Pik3c2b	UTSW	1	133074627	splice site	probably null
X0060:Pik3c2b	UTSW	1	133084936	missense	probably benign	0.18
Z1176:Pik3c2b	UTSW	1	133066553	missense	probably damaging	1.00
Z1176:Pik3c2b	UTSW	1	133099686	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGAGGAAATGGATGCTGGCC -3'
(R):5'- TGTAGAAGTCCAAGGCTGGCTC -3'

Sequencing Primer
(F):5'- ATGCTGGCCTGGATTATGTCAC -3'
(R):5'- TGGCTCATCCCAGCTGATAAGAG -3'

Posted On

2018-11-28