Incidental Mutation 'R6954:Dennd1b'
ID541350
Institutional Source Beutler Lab
Gene Symbol Dennd1b
Ensembl Gene ENSMUSG00000056268
Gene NameDENN/MADD domain containing 1B
Synonyms4632404N19Rik, 6820401H01Rik, 4930467M19Rik, F730008N07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6954 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location138963435-139178960 bp(+) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) T to A at 139168945 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094505] [ENSMUST00000168527] [ENSMUST00000200429]
Predicted Effect unknown
Transcript: ENSMUST00000094505
AA Change: I477N
SMART Domains Protein: ENSMUSP00000092082
Gene: ENSMUSG00000056268
AA Change: I477N

DomainStartEndE-ValueType
DENN 15 196 1.14e-74 SMART
dDENN 227 293 1.07e-20 SMART
Predicted Effect unknown
Transcript: ENSMUST00000168527
AA Change: I552N
SMART Domains Protein: ENSMUSP00000127580
Gene: ENSMUSG00000056268
AA Change: I552N

DomainStartEndE-ValueType
uDENN 9 89 7.86e-28 SMART
DENN 90 271 1.14e-74 SMART
dDENN 302 368 1.07e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200429
SMART Domains Protein: ENSMUSP00000143783
Gene: ENSMUSG00000056268

DomainStartEndE-ValueType
uDENN 9 89 3.2e-31 SMART
DENN 90 271 4.8e-78 SMART
low complexity region 307 318 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Clathrin (see MIM 118955)-mediated endocytosis is a major mechanism for internalization of proteins and lipids. Members of the connecdenn family, such as DENND1B, function as guanine nucleotide exchange factors (GEFs) for the early endosomal small GTPase RAB35 (MIM 604199) and bind to clathrin and clathrin adaptor protein-2 (AP2; see MIM 601024). Thus, connecdenns link RAB35 activation with the clathrin machinery (Marat and McPherson, 2010 [PubMed 20154091]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous KO results in enhanced allergic responses to aerosolized antigen challenges caused by delayed TCR down-modulation following receptor activation in T helper 2 cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik T A 11: 58,608,488 Y168F probably benign Het
4930451I11Rik A T 7: 126,830,637 probably null Het
Alox5 A C 6: 116,420,280 Y314* probably null Het
Ap4e1 T C 2: 127,064,951 S1044P probably benign Het
Ash2l A G 8: 25,822,768 V391A possibly damaging Het
B4galnt4 A G 7: 141,067,232 T326A probably benign Het
Ccm2 T A 11: 6,594,239 I345N probably damaging Het
Cntnap3 G A 13: 64,748,559 H1034Y probably benign Het
Cpsf1 A G 15: 76,599,496 L849S probably damaging Het
Ctrb1 A G 8: 111,686,664 S239P probably damaging Het
D13Ertd608e A G 13: 119,846,130 D20G possibly damaging Het
Dnah17 A G 11: 118,066,432 I2773T probably damaging Het
Eif2b2 T A 12: 85,226,043 F267L probably damaging Het
Fcrls A G 3: 87,263,676 probably benign Het
Furin G T 7: 80,396,964 D181E possibly damaging Het
Gm29106 T A 1: 118,200,587 C670S probably damaging Het
Gm6309 A T 5: 146,168,490 D204E possibly damaging Het
Hsf2 T A 10: 57,504,643 I191N probably damaging Het
Hspa12a T C 19: 58,799,692 D566G probably benign Het
Igf1 G C 10: 87,864,860 V49L probably damaging Het
Igfbpl1 C T 4: 45,826,663 C44Y probably damaging Het
Letm1 G A 5: 33,782,507 R16C probably benign Het
Marf1 A G 16: 14,138,520 V819A probably damaging Het
Mfsd4b4 A T 10: 39,891,952 S428T probably benign Het
Myo1d T C 11: 80,674,957 I347M probably benign Het
Myo9b A G 8: 71,290,819 I175V probably damaging Het
Naip5 A T 13: 100,223,414 V438E probably damaging Het
Nup205 T A 6: 35,208,109 V768E possibly damaging Het
Olfr1015 T A 2: 85,786,382 Y290* probably null Het
Olfr731 A T 14: 50,238,110 Y258* probably null Het
Pcdh15 C T 10: 74,645,989 H1651Y possibly damaging Het
Pdgfra A T 5: 75,173,394 Q376L possibly damaging Het
Pign T C 1: 105,553,897 I791M probably benign Het
Pik3c2b T G 1: 133,066,303 S2A possibly damaging Het
Pip5k1a A T 3: 95,068,247 I304K probably damaging Het
Pkdrej A T 15: 85,817,853 L1294* probably null Het
Pprc1 T C 19: 46,064,433 S797P probably damaging Het
Prob1 A G 18: 35,654,268 V311A probably benign Het
Prune2 C A 19: 17,000,021 T40K probably damaging Het
Rif1 T G 2: 52,112,691 D2052E probably benign Het
Sall1 A G 8: 89,032,891 V195A probably damaging Het
Scfd1 T C 12: 51,427,946 probably null Het
Sidt2 A T 9: 45,952,850 N123K probably benign Het
Slc22a6 G A 19: 8,622,096 A320T probably benign Het
Slc25a10 A G 11: 120,498,147 H279R probably benign Het
Slc35b4 A G 6: 34,158,621 V252A probably benign Het
Slc46a3 T C 5: 147,886,340 T231A probably benign Het
Stxbp1 T A 2: 32,801,893 H429L probably damaging Het
Tas2r134 C T 2: 51,627,770 T87I probably benign Het
Tdpoz2 A T 3: 93,652,275 L130H probably damaging Het
Tmem69 T C 4: 116,554,724 probably null Het
Tmppe G A 9: 114,405,523 V297I probably benign Het
Ung G T 5: 114,131,337 A37S probably benign Het
Vdac1 T C 11: 52,386,373 Y237H probably damaging Het
Vgll4 T C 6: 114,921,367 Y11C probably damaging Het
Vmn1r24 A G 6: 57,956,452 I27T probably benign Het
Zfp280b T A 10: 76,039,688 M467K probably benign Het
Zkscan4 A G 13: 21,484,365 I329V probably damaging Het
Other mutations in Dennd1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Dennd1b APN 1 139062940 missense probably damaging 1.00
IGL00510:Dennd1b APN 1 139102071 missense probably damaging 1.00
IGL00671:Dennd1b APN 1 139133737 missense possibly damaging 0.94
IGL00937:Dennd1b APN 1 139170239 missense probably benign 0.01
IGL00959:Dennd1b APN 1 139143888 splice site probably benign
IGL01446:Dennd1b APN 1 139023110 missense possibly damaging 0.61
IGL01610:Dennd1b APN 1 139169766 utr 3 prime probably benign
IGL02275:Dennd1b APN 1 139081254 missense probably damaging 1.00
IGL02851:Dennd1b APN 1 139168967 utr 3 prime probably benign
IGL02995:Dennd1b APN 1 139081242 missense probably damaging 1.00
IGL03089:Dennd1b APN 1 139102029 missense possibly damaging 0.94
IGL03240:Dennd1b APN 1 139139392 missense possibly damaging 0.63
IGL03267:Dennd1b APN 1 139062861 nonsense probably null
Dendrite UTSW 1 139053417 critical splice donor site probably null
LCD18:Dennd1b UTSW 1 139114764 intron probably benign
PIT4418001:Dennd1b UTSW 1 139081261 missense
PIT4504001:Dennd1b UTSW 1 139040004 missense probably benign 0.28
R0426:Dennd1b UTSW 1 139170196 missense probably benign
R0445:Dennd1b UTSW 1 139167765 splice site probably benign
R0497:Dennd1b UTSW 1 139039986 splice site probably benign
R0627:Dennd1b UTSW 1 139081219 missense probably damaging 1.00
R1027:Dennd1b UTSW 1 139041962 missense probably damaging 1.00
R1599:Dennd1b UTSW 1 139167730 missense probably benign 0.01
R1703:Dennd1b UTSW 1 139169754 critical splice acceptor site probably null
R1844:Dennd1b UTSW 1 139090405 intron probably null
R1943:Dennd1b UTSW 1 139168952 utr 3 prime probably benign
R2504:Dennd1b UTSW 1 139170170 utr 3 prime probably benign
R2866:Dennd1b UTSW 1 139170281 missense possibly damaging 0.58
R3109:Dennd1b UTSW 1 139041916 splice site probably benign
R3843:Dennd1b UTSW 1 139053354 missense probably damaging 1.00
R3926:Dennd1b UTSW 1 139143959 missense probably benign 0.00
R4258:Dennd1b UTSW 1 139062940 missense probably damaging 1.00
R4504:Dennd1b UTSW 1 139085927 missense possibly damaging 0.82
R4805:Dennd1b UTSW 1 139053384 missense probably damaging 1.00
R4922:Dennd1b UTSW 1 139085914 missense probably damaging 0.99
R4954:Dennd1b UTSW 1 139053386 missense probably damaging 1.00
R5098:Dennd1b UTSW 1 139133721 missense probably damaging 0.97
R5205:Dennd1b UTSW 1 139054568 missense probably benign 0.00
R5240:Dennd1b UTSW 1 139062877 missense probably damaging 1.00
R5383:Dennd1b UTSW 1 139167671 missense probably benign
R5504:Dennd1b UTSW 1 139090508 missense probably benign 0.07
R5702:Dennd1b UTSW 1 139133675 missense probably damaging 1.00
R5801:Dennd1b UTSW 1 139039989 splice site probably null
R6144:Dennd1b UTSW 1 139081255 missense probably damaging 1.00
R6190:Dennd1b UTSW 1 139133675 missense probably damaging 1.00
R6192:Dennd1b UTSW 1 139167718 missense probably benign 0.00
R6289:Dennd1b UTSW 1 139168945 utr 3 prime probably benign
R6453:Dennd1b UTSW 1 139143948 missense probably benign 0.07
R6479:Dennd1b UTSW 1 139041960 intron probably benign
R6940:Dennd1b UTSW 1 139053417 critical splice donor site probably null
R7183:Dennd1b UTSW 1 139170252 missense unknown
R7710:Dennd1b UTSW 1 139062932 missense probably damaging 1.00
R7742:Dennd1b UTSW 1 139062873 missense probably damaging 1.00
R7796:Dennd1b UTSW 1 139062873 missense probably damaging 1.00
R7871:Dennd1b UTSW 1 139062873 missense probably damaging 1.00
R7954:Dennd1b UTSW 1 139062873 missense probably damaging 1.00
RF008:Dennd1b UTSW 1 139053397 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTCCAGTTGTGACCTTGTTG -3'
(R):5'- ACCACAGTTTGACGTTTCTGTAC -3'

Sequencing Primer
(F):5'- CTGGCGTTTGTTGTTTAGCAAG -3'
(R):5'- ACGTTTCTGTACTTACCTAGAGG -3'
Posted On2018-11-28