Incidental Mutation 'R6954:Tas2r134'
ID541352
Institutional Source Beutler Lab
Gene Symbol Tas2r134
Ensembl Gene ENSMUSG00000056115
Gene Nametaste receptor, type 2, member 134
SynonymsT2R134, Tas2r34
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R6954 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location51627511-51628408 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 51627770 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 87 (T87I)
Ref Sequence ENSEMBL: ENSMUSP00000064657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070028]
Predicted Effect probably benign
Transcript: ENSMUST00000070028
AA Change: T87I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000064657
Gene: ENSMUSG00000056115
AA Change: T87I

DomainStartEndE-ValueType
Pfam:TAS2R 1 291 1.4e-75 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik T A 11: 58,608,488 Y168F probably benign Het
4930451I11Rik A T 7: 126,830,637 probably null Het
Alox5 A C 6: 116,420,280 Y314* probably null Het
Ap4e1 T C 2: 127,064,951 S1044P probably benign Het
Ash2l A G 8: 25,822,768 V391A possibly damaging Het
B4galnt4 A G 7: 141,067,232 T326A probably benign Het
Ccm2 T A 11: 6,594,239 I345N probably damaging Het
Cntnap3 G A 13: 64,748,559 H1034Y probably benign Het
Cpsf1 A G 15: 76,599,496 L849S probably damaging Het
Ctrb1 A G 8: 111,686,664 S239P probably damaging Het
D13Ertd608e A G 13: 119,846,130 D20G possibly damaging Het
Dennd1b T A 1: 139,168,945 probably benign Het
Dnah17 A G 11: 118,066,432 I2773T probably damaging Het
Eif2b2 T A 12: 85,226,043 F267L probably damaging Het
Fcrls A G 3: 87,263,676 probably benign Het
Furin G T 7: 80,396,964 D181E possibly damaging Het
Gm29106 T A 1: 118,200,587 C670S probably damaging Het
Gm6309 A T 5: 146,168,490 D204E possibly damaging Het
Hsf2 T A 10: 57,504,643 I191N probably damaging Het
Hspa12a T C 19: 58,799,692 D566G probably benign Het
Igf1 G C 10: 87,864,860 V49L probably damaging Het
Igfbpl1 C T 4: 45,826,663 C44Y probably damaging Het
Letm1 G A 5: 33,782,507 R16C probably benign Het
Marf1 A G 16: 14,138,520 V819A probably damaging Het
Mfsd4b4 A T 10: 39,891,952 S428T probably benign Het
Myo1d T C 11: 80,674,957 I347M probably benign Het
Myo9b A G 8: 71,290,819 I175V probably damaging Het
Naip5 A T 13: 100,223,414 V438E probably damaging Het
Nup205 T A 6: 35,208,109 V768E possibly damaging Het
Olfr1015 T A 2: 85,786,382 Y290* probably null Het
Olfr731 A T 14: 50,238,110 Y258* probably null Het
Pcdh15 C T 10: 74,645,989 H1651Y possibly damaging Het
Pdgfra A T 5: 75,173,394 Q376L possibly damaging Het
Pign T C 1: 105,553,897 I791M probably benign Het
Pik3c2b T G 1: 133,066,303 S2A possibly damaging Het
Pip5k1a A T 3: 95,068,247 I304K probably damaging Het
Pkdrej A T 15: 85,817,853 L1294* probably null Het
Pprc1 T C 19: 46,064,433 S797P probably damaging Het
Prob1 A G 18: 35,654,268 V311A probably benign Het
Prune2 C A 19: 17,000,021 T40K probably damaging Het
Rif1 T G 2: 52,112,691 D2052E probably benign Het
Sall1 A G 8: 89,032,891 V195A probably damaging Het
Scfd1 T C 12: 51,427,946 probably null Het
Sidt2 A T 9: 45,952,850 N123K probably benign Het
Slc22a6 G A 19: 8,622,096 A320T probably benign Het
Slc25a10 A G 11: 120,498,147 H279R probably benign Het
Slc35b4 A G 6: 34,158,621 V252A probably benign Het
Slc46a3 T C 5: 147,886,340 T231A probably benign Het
Stxbp1 T A 2: 32,801,893 H429L probably damaging Het
Tdpoz2 A T 3: 93,652,275 L130H probably damaging Het
Tmem69 T C 4: 116,554,724 probably null Het
Tmppe G A 9: 114,405,523 V297I probably benign Het
Ung G T 5: 114,131,337 A37S probably benign Het
Vdac1 T C 11: 52,386,373 Y237H probably damaging Het
Vgll4 T C 6: 114,921,367 Y11C probably damaging Het
Vmn1r24 A G 6: 57,956,452 I27T probably benign Het
Zfp280b T A 10: 76,039,688 M467K probably benign Het
Zkscan4 A G 13: 21,484,365 I329V probably damaging Het
Other mutations in Tas2r134
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Tas2r134 APN 2 51628088 missense possibly damaging 0.90
IGL00563:Tas2r134 APN 2 51628088 missense possibly damaging 0.90
IGL01121:Tas2r134 APN 2 51627989 missense probably damaging 1.00
IGL01122:Tas2r134 APN 2 51627659 missense probably damaging 1.00
IGL01128:Tas2r134 APN 2 51627659 missense probably damaging 1.00
IGL01132:Tas2r134 APN 2 51627659 missense probably damaging 1.00
IGL01312:Tas2r134 APN 2 51628235 missense probably damaging 1.00
IGL01419:Tas2r134 APN 2 51627747 nonsense probably null
IGL01774:Tas2r134 APN 2 51628148 missense probably benign 0.07
IGL02735:Tas2r134 APN 2 51627827 missense probably damaging 1.00
R0799:Tas2r134 UTSW 2 51628373 missense probably benign 0.00
R1205:Tas2r134 UTSW 2 51627986 missense probably benign 0.00
R2267:Tas2r134 UTSW 2 51628237 missense probably benign 0.01
R3736:Tas2r134 UTSW 2 51627774 missense probably damaging 1.00
R5254:Tas2r134 UTSW 2 51627547 missense probably benign 0.39
R5752:Tas2r134 UTSW 2 51627868 missense probably damaging 1.00
R6162:Tas2r134 UTSW 2 51627559 missense probably damaging 1.00
R6940:Tas2r134 UTSW 2 51628136 missense probably benign 0.00
R6996:Tas2r134 UTSW 2 51627589 missense probably benign 0.00
R7206:Tas2r134 UTSW 2 51628108 missense probably benign 0.02
R7303:Tas2r134 UTSW 2 51628133 missense probably benign 0.01
R7348:Tas2r134 UTSW 2 51628402 missense possibly damaging 0.92
R7479:Tas2r134 UTSW 2 51627529 missense not run
R7575:Tas2r134 UTSW 2 51628154 missense probably damaging 1.00
R7686:Tas2r134 UTSW 2 51628243 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- TTGCTGCAAAATGGCTTTATGG -3'
(R):5'- CCATCTGAAGGGCAATTGTG -3'

Sequencing Primer
(F):5'- TTATGGCCACCGTGCTG -3'
(R):5'- CCATCTGAAGGGCAATTGTGTTTCC -3'
Posted On2018-11-28