Incidental Mutation 'R6954:Pip5k1a'
ID541357
Institutional Source Beutler Lab
Gene Symbol Pip5k1a
Ensembl Gene ENSMUSG00000028126
Gene Namephosphatidylinositol-4-phosphate 5-kinase, type 1 alpha
SynonymsPipk5a
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6954 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location95058530-95106930 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 95068247 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 304 (I304K)
Ref Sequence ENSEMBL: ENSMUSP00000005768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005768] [ENSMUST00000107232] [ENSMUST00000107233] [ENSMUST00000107236]
Predicted Effect probably damaging
Transcript: ENSMUST00000005768
AA Change: I304K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005768
Gene: ENSMUSG00000028126
AA Change: I304K

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
PIPKc 93 434 2.79e-184 SMART
low complexity region 447 461 N/A INTRINSIC
low complexity region 508 523 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107232
AA Change: I304K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102851
Gene: ENSMUSG00000028126
AA Change: I304K

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
PIPKc 93 434 2.79e-184 SMART
low complexity region 460 475 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107233
AA Change: I306K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102852
Gene: ENSMUSG00000028126
AA Change: I306K

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 18 30 N/A INTRINSIC
PIPKc 95 436 2.79e-184 SMART
low complexity region 449 463 N/A INTRINSIC
low complexity region 510 525 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107236
AA Change: I305K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102855
Gene: ENSMUSG00000028126
AA Change: I305K

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 18 29 N/A INTRINSIC
PIPKc 94 435 2.79e-184 SMART
low complexity region 448 462 N/A INTRINSIC
low complexity region 509 524 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 98% (57/58)
MGI Phenotype PHENOTYPE: A gene trap insertion into an intron of this gene results in no obvious phenotype. Mice homozygous for a knock-out allele exhibit partial lethality and reduced male fertility associated with asthenozoospermia and abnormal midpiece morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik T A 11: 58,608,488 Y168F probably benign Het
4930451I11Rik A T 7: 126,830,637 probably null Het
Alox5 A C 6: 116,420,280 Y314* probably null Het
Ap4e1 T C 2: 127,064,951 S1044P probably benign Het
Ash2l A G 8: 25,822,768 V391A possibly damaging Het
B4galnt4 A G 7: 141,067,232 T326A probably benign Het
Ccm2 T A 11: 6,594,239 I345N probably damaging Het
Cntnap3 G A 13: 64,748,559 H1034Y probably benign Het
Cpsf1 A G 15: 76,599,496 L849S probably damaging Het
Ctrb1 A G 8: 111,686,664 S239P probably damaging Het
D13Ertd608e A G 13: 119,846,130 D20G possibly damaging Het
Dennd1b T A 1: 139,168,945 probably benign Het
Dnah17 A G 11: 118,066,432 I2773T probably damaging Het
Eif2b2 T A 12: 85,226,043 F267L probably damaging Het
Fcrls A G 3: 87,263,676 probably benign Het
Furin G T 7: 80,396,964 D181E possibly damaging Het
Gm29106 T A 1: 118,200,587 C670S probably damaging Het
Gm6309 A T 5: 146,168,490 D204E possibly damaging Het
Hsf2 T A 10: 57,504,643 I191N probably damaging Het
Hspa12a T C 19: 58,799,692 D566G probably benign Het
Igf1 G C 10: 87,864,860 V49L probably damaging Het
Igfbpl1 C T 4: 45,826,663 C44Y probably damaging Het
Letm1 G A 5: 33,782,507 R16C probably benign Het
Marf1 A G 16: 14,138,520 V819A probably damaging Het
Mfsd4b4 A T 10: 39,891,952 S428T probably benign Het
Myo1d T C 11: 80,674,957 I347M probably benign Het
Myo9b A G 8: 71,290,819 I175V probably damaging Het
Naip5 A T 13: 100,223,414 V438E probably damaging Het
Nup205 T A 6: 35,208,109 V768E possibly damaging Het
Olfr1015 T A 2: 85,786,382 Y290* probably null Het
Olfr731 A T 14: 50,238,110 Y258* probably null Het
Pcdh15 C T 10: 74,645,989 H1651Y possibly damaging Het
Pdgfra A T 5: 75,173,394 Q376L possibly damaging Het
Pign T C 1: 105,553,897 I791M probably benign Het
Pik3c2b T G 1: 133,066,303 S2A possibly damaging Het
Pkdrej A T 15: 85,817,853 L1294* probably null Het
Pprc1 T C 19: 46,064,433 S797P probably damaging Het
Prob1 A G 18: 35,654,268 V311A probably benign Het
Prune2 C A 19: 17,000,021 T40K probably damaging Het
Rif1 T G 2: 52,112,691 D2052E probably benign Het
Sall1 A G 8: 89,032,891 V195A probably damaging Het
Scfd1 T C 12: 51,427,946 probably null Het
Sidt2 A T 9: 45,952,850 N123K probably benign Het
Slc22a6 G A 19: 8,622,096 A320T probably benign Het
Slc25a10 A G 11: 120,498,147 H279R probably benign Het
Slc35b4 A G 6: 34,158,621 V252A probably benign Het
Slc46a3 T C 5: 147,886,340 T231A probably benign Het
Stxbp1 T A 2: 32,801,893 H429L probably damaging Het
Tas2r134 C T 2: 51,627,770 T87I probably benign Het
Tdpoz2 A T 3: 93,652,275 L130H probably damaging Het
Tmem69 T C 4: 116,554,724 probably null Het
Tmppe G A 9: 114,405,523 V297I probably benign Het
Ung G T 5: 114,131,337 A37S probably benign Het
Vdac1 T C 11: 52,386,373 Y237H probably damaging Het
Vgll4 T C 6: 114,921,367 Y11C probably damaging Het
Vmn1r24 A G 6: 57,956,452 I27T probably benign Het
Zfp280b T A 10: 76,039,688 M467K probably benign Het
Zkscan4 A G 13: 21,484,365 I329V probably damaging Het
Other mutations in Pip5k1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01455:Pip5k1a APN 3 95068160 missense probably benign 0.15
IGL01647:Pip5k1a APN 3 95074072 missense probably damaging 1.00
IGL02536:Pip5k1a APN 3 95064396 missense probably benign 0.01
IGL02612:Pip5k1a APN 3 95067413 missense probably benign 0.02
Biden UTSW 3 95068121 missense probably damaging 1.00
Time UTSW 3 95060498 missense possibly damaging 0.76
R0109:Pip5k1a UTSW 3 95065442 missense probably benign 0.03
R0217:Pip5k1a UTSW 3 95073991 critical splice donor site probably null
R0891:Pip5k1a UTSW 3 95065520 splice site probably benign
R1157:Pip5k1a UTSW 3 95078112 missense probably benign 0.15
R1692:Pip5k1a UTSW 3 95063730 missense probably benign 0.00
R2176:Pip5k1a UTSW 3 95065496 missense probably damaging 1.00
R2187:Pip5k1a UTSW 3 95071918 missense probably damaging 1.00
R3693:Pip5k1a UTSW 3 95078187 splice site probably benign
R3933:Pip5k1a UTSW 3 95072003 missense probably benign 0.00
R4405:Pip5k1a UTSW 3 95068059 critical splice donor site probably null
R4903:Pip5k1a UTSW 3 95070783 missense probably benign 0.01
R4964:Pip5k1a UTSW 3 95070783 missense probably benign 0.01
R5652:Pip5k1a UTSW 3 95067439 missense probably benign
R6314:Pip5k1a UTSW 3 95068121 missense probably damaging 1.00
R7090:Pip5k1a UTSW 3 95060498 missense possibly damaging 0.76
R7432:Pip5k1a UTSW 3 95074120 missense probably benign 0.01
X0017:Pip5k1a UTSW 3 95078163 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGCACTACAAACTTGGACAC -3'
(R):5'- CATGGGGAACTTGGTGAGAC -3'

Sequencing Primer
(F):5'- GGTCCTCAGTCTCCACAGTG -3'
(R):5'- CATCATCATCTATTATTCAAATGGG -3'
Posted On2018-11-28