Incidental Mutation 'R6954:Ung'
ID541359
Institutional Source Beutler Lab
Gene Symbol Ung
Ensembl Gene ENSMUSG00000029591
Gene Nameuracil DNA glycosylase
SynonymsUNG1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.901) question?
Stock #R6954 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location114130386-114139323 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 114131337 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 37 (A37S)
Ref Sequence ENSEMBL: ENSMUSP00000142484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031587] [ENSMUST00000053657] [ENSMUST00000102584] [ENSMUST00000112275] [ENSMUST00000112279] [ENSMUST00000137402] [ENSMUST00000143455] [ENSMUST00000149418]
Predicted Effect probably benign
Transcript: ENSMUST00000031587
AA Change: A48S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000031587
Gene: ENSMUSG00000029591
AA Change: A48S

DomainStartEndE-ValueType
low complexity region 72 81 N/A INTRINSIC
UDG 132 293 5.86e-35 SMART
UreE_C 132 293 5.86e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000053657
SMART Domains Protein: ENSMUSP00000056043
Gene: ENSMUSG00000044339

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
Pfam:2OG-FeII_Oxy_2 47 232 1.9e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102584
AA Change: A37S

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000099644
Gene: ENSMUSG00000029591
AA Change: A37S

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 61 70 N/A INTRINSIC
UDG 121 282 5.86e-35 SMART
UreE_C 121 282 5.86e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112275
SMART Domains Protein: ENSMUSP00000107894
Gene: ENSMUSG00000029591

DomainStartEndE-ValueType
UDG 25 186 5.86e-35 SMART
UreE_C 25 186 5.86e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112279
SMART Domains Protein: ENSMUSP00000107898
Gene: ENSMUSG00000044339

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
Pfam:2OG-FeII_Oxy_2 47 232 5.4e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137402
SMART Domains Protein: ENSMUSP00000114140
Gene: ENSMUSG00000029591

DomainStartEndE-ValueType
UDG 35 184 2.05e-25 SMART
UreE_C 35 184 2.05e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143455
AA Change: A37S

PolyPhen 2 Score 0.249 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000142484
Gene: ENSMUSG00000029591
AA Change: A37S

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 61 70 N/A INTRINSIC
PDB:2SSP|E 76 127 3e-27 PDB
SCOP:d3euga_ 79 127 1e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149418
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of several uracil-DNA glycosylases. One important function of uracil-DNA glycosylases is to prevent mutagenesis by eliminating uracil from DNA molecules by cleaving the N-glycosylic bond and initiating the base-excision repair (BER) pathway. Uracil bases occur from cytosine deamination or misincorporation of dUMP residues. Alternative promoter usage and splicing of this gene leads to two different isoforms: the mitochondrial UNG1 and the nuclear UNG2. The UNG2 term was used as a previous symbol for the CCNO gene (GeneID 10309), which has been confused with this gene, in the literature and some databases. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous null mutants incorporate an elevated level of uracil into DNA of dividing cells. In hypermutation at immunoglobulin genes, mutations at C/G pairs are shifted toward transitions, and class-switch recombination is reduced. Homozygous null mutants display increased ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik T A 11: 58,608,488 Y168F probably benign Het
4930451I11Rik A T 7: 126,830,637 probably null Het
Alox5 A C 6: 116,420,280 Y314* probably null Het
Ap4e1 T C 2: 127,064,951 S1044P probably benign Het
Ash2l A G 8: 25,822,768 V391A possibly damaging Het
B4galnt4 A G 7: 141,067,232 T326A probably benign Het
Ccm2 T A 11: 6,594,239 I345N probably damaging Het
Cntnap3 G A 13: 64,748,559 H1034Y probably benign Het
Cpsf1 A G 15: 76,599,496 L849S probably damaging Het
Ctrb1 A G 8: 111,686,664 S239P probably damaging Het
D13Ertd608e A G 13: 119,846,130 D20G possibly damaging Het
Dennd1b T A 1: 139,168,945 probably benign Het
Dnah17 A G 11: 118,066,432 I2773T probably damaging Het
Eif2b2 T A 12: 85,226,043 F267L probably damaging Het
Fcrls A G 3: 87,263,676 probably benign Het
Furin G T 7: 80,396,964 D181E possibly damaging Het
Gm29106 T A 1: 118,200,587 C670S probably damaging Het
Gm6309 A T 5: 146,168,490 D204E possibly damaging Het
Hsf2 T A 10: 57,504,643 I191N probably damaging Het
Hspa12a T C 19: 58,799,692 D566G probably benign Het
Igf1 G C 10: 87,864,860 V49L probably damaging Het
Igfbpl1 C T 4: 45,826,663 C44Y probably damaging Het
Letm1 G A 5: 33,782,507 R16C probably benign Het
Marf1 A G 16: 14,138,520 V819A probably damaging Het
Mfsd4b4 A T 10: 39,891,952 S428T probably benign Het
Myo1d T C 11: 80,674,957 I347M probably benign Het
Myo9b A G 8: 71,290,819 I175V probably damaging Het
Naip5 A T 13: 100,223,414 V438E probably damaging Het
Nup205 T A 6: 35,208,109 V768E possibly damaging Het
Olfr1015 T A 2: 85,786,382 Y290* probably null Het
Olfr731 A T 14: 50,238,110 Y258* probably null Het
Pcdh15 C T 10: 74,645,989 H1651Y possibly damaging Het
Pdgfra A T 5: 75,173,394 Q376L possibly damaging Het
Pign T C 1: 105,553,897 I791M probably benign Het
Pik3c2b T G 1: 133,066,303 S2A possibly damaging Het
Pip5k1a A T 3: 95,068,247 I304K probably damaging Het
Pkdrej A T 15: 85,817,853 L1294* probably null Het
Pprc1 T C 19: 46,064,433 S797P probably damaging Het
Prob1 A G 18: 35,654,268 V311A probably benign Het
Prune2 C A 19: 17,000,021 T40K probably damaging Het
Rif1 T G 2: 52,112,691 D2052E probably benign Het
Sall1 A G 8: 89,032,891 V195A probably damaging Het
Scfd1 T C 12: 51,427,946 probably null Het
Sidt2 A T 9: 45,952,850 N123K probably benign Het
Slc22a6 G A 19: 8,622,096 A320T probably benign Het
Slc25a10 A G 11: 120,498,147 H279R probably benign Het
Slc35b4 A G 6: 34,158,621 V252A probably benign Het
Slc46a3 T C 5: 147,886,340 T231A probably benign Het
Stxbp1 T A 2: 32,801,893 H429L probably damaging Het
Tas2r134 C T 2: 51,627,770 T87I probably benign Het
Tdpoz2 A T 3: 93,652,275 L130H probably damaging Het
Tmem69 T C 4: 116,554,724 probably null Het
Tmppe G A 9: 114,405,523 V297I probably benign Het
Vdac1 T C 11: 52,386,373 Y237H probably damaging Het
Vgll4 T C 6: 114,921,367 Y11C probably damaging Het
Vmn1r24 A G 6: 57,956,452 I27T probably benign Het
Zfp280b T A 10: 76,039,688 M467K probably benign Het
Zkscan4 A G 13: 21,484,365 I329V probably damaging Het
Other mutations in Ung
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01583:Ung APN 5 114137308 missense possibly damaging 0.50
IGL01995:Ung APN 5 114136386 missense probably benign 0.30
IGL02084:Ung APN 5 114130576 missense probably benign 0.00
R1219:Ung UTSW 5 114132167 unclassified probably benign
R1617:Ung UTSW 5 114131354 missense probably benign 0.14
R2513:Ung UTSW 5 114137192 missense probably benign 0.11
R4078:Ung UTSW 5 114130623 unclassified probably null
R4079:Ung UTSW 5 114130623 unclassified probably null
R6210:Ung UTSW 5 114131377 missense probably benign 0.15
R6258:Ung UTSW 5 114137300 missense probably benign 0.12
R7288:Ung UTSW 5 114131254 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTTTTGCCGCGAAAAGCC -3'
(R):5'- ATCGTTGTCAAGTGTGGCAC -3'

Sequencing Primer
(F):5'- GCGAAAAGCCTGCGTGG -3'
(R):5'- TTGTCAAGTGTGGCACGGAAAG -3'
Posted On2018-11-28