Incidental Mutation 'R6954:Slc35b4'
ID541362
Institutional Source Beutler Lab
Gene Symbol Slc35b4
Ensembl Gene ENSMUSG00000018999
Gene Namesolute carrier family 35, member B4
Synonyms4930474D06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6954 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location34153380-34177111 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34158621 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 252 (V252A)
Ref Sequence ENSEMBL: ENSMUSP00000019143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019143] [ENSMUST00000138250]
Predicted Effect probably benign
Transcript: ENSMUST00000019143
AA Change: V252A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000019143
Gene: ENSMUSG00000018999
AA Change: V252A

DomainStartEndE-ValueType
Pfam:UAA 2 314 1.7e-120 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138250
Meta Mutation Damage Score 0.0950 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glycosyltransferases, such as SLC35B4, transport nucleotide sugars from the cytoplasm where they are synthesized, to the Golgi apparatus where they are utilized in the synthesis of glycoproteins, glycolipids, and proteoglycans (Ashikov et al., 2005 [PubMed 15911612]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik T A 11: 58,608,488 Y168F probably benign Het
4930451I11Rik A T 7: 126,830,637 probably null Het
Alox5 A C 6: 116,420,280 Y314* probably null Het
Ap4e1 T C 2: 127,064,951 S1044P probably benign Het
Ash2l A G 8: 25,822,768 V391A possibly damaging Het
B4galnt4 A G 7: 141,067,232 T326A probably benign Het
Ccm2 T A 11: 6,594,239 I345N probably damaging Het
Cntnap3 G A 13: 64,748,559 H1034Y probably benign Het
Cpsf1 A G 15: 76,599,496 L849S probably damaging Het
Ctrb1 A G 8: 111,686,664 S239P probably damaging Het
D13Ertd608e A G 13: 119,846,130 D20G possibly damaging Het
Dennd1b T A 1: 139,168,945 probably benign Het
Dnah17 A G 11: 118,066,432 I2773T probably damaging Het
Eif2b2 T A 12: 85,226,043 F267L probably damaging Het
Fcrls A G 3: 87,263,676 probably benign Het
Furin G T 7: 80,396,964 D181E possibly damaging Het
Gm29106 T A 1: 118,200,587 C670S probably damaging Het
Gm6309 A T 5: 146,168,490 D204E possibly damaging Het
Hsf2 T A 10: 57,504,643 I191N probably damaging Het
Hspa12a T C 19: 58,799,692 D566G probably benign Het
Igf1 G C 10: 87,864,860 V49L probably damaging Het
Igfbpl1 C T 4: 45,826,663 C44Y probably damaging Het
Letm1 G A 5: 33,782,507 R16C probably benign Het
Marf1 A G 16: 14,138,520 V819A probably damaging Het
Mfsd4b4 A T 10: 39,891,952 S428T probably benign Het
Myo1d T C 11: 80,674,957 I347M probably benign Het
Myo9b A G 8: 71,290,819 I175V probably damaging Het
Naip5 A T 13: 100,223,414 V438E probably damaging Het
Nup205 T A 6: 35,208,109 V768E possibly damaging Het
Olfr1015 T A 2: 85,786,382 Y290* probably null Het
Olfr731 A T 14: 50,238,110 Y258* probably null Het
Pcdh15 C T 10: 74,645,989 H1651Y possibly damaging Het
Pdgfra A T 5: 75,173,394 Q376L possibly damaging Het
Pign T C 1: 105,553,897 I791M probably benign Het
Pik3c2b T G 1: 133,066,303 S2A possibly damaging Het
Pip5k1a A T 3: 95,068,247 I304K probably damaging Het
Pkdrej A T 15: 85,817,853 L1294* probably null Het
Pprc1 T C 19: 46,064,433 S797P probably damaging Het
Prob1 A G 18: 35,654,268 V311A probably benign Het
Prune2 C A 19: 17,000,021 T40K probably damaging Het
Rif1 T G 2: 52,112,691 D2052E probably benign Het
Sall1 A G 8: 89,032,891 V195A probably damaging Het
Scfd1 T C 12: 51,427,946 probably null Het
Sidt2 A T 9: 45,952,850 N123K probably benign Het
Slc22a6 G A 19: 8,622,096 A320T probably benign Het
Slc25a10 A G 11: 120,498,147 H279R probably benign Het
Slc46a3 T C 5: 147,886,340 T231A probably benign Het
Stxbp1 T A 2: 32,801,893 H429L probably damaging Het
Tas2r134 C T 2: 51,627,770 T87I probably benign Het
Tdpoz2 A T 3: 93,652,275 L130H probably damaging Het
Tmem69 T C 4: 116,554,724 probably null Het
Tmppe G A 9: 114,405,523 V297I probably benign Het
Ung G T 5: 114,131,337 A37S probably benign Het
Vdac1 T C 11: 52,386,373 Y237H probably damaging Het
Vgll4 T C 6: 114,921,367 Y11C probably damaging Het
Vmn1r24 A G 6: 57,956,452 I27T probably benign Het
Zfp280b T A 10: 76,039,688 M467K probably benign Het
Zkscan4 A G 13: 21,484,365 I329V probably damaging Het
Other mutations in Slc35b4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01646:Slc35b4 APN 6 34158429 missense probably benign 0.03
IGL01667:Slc35b4 APN 6 34167675 missense possibly damaging 0.81
IGL01670:Slc35b4 APN 6 34170549 missense probably benign 0.00
IGL02015:Slc35b4 APN 6 34170548 missense probably damaging 1.00
IGL02710:Slc35b4 APN 6 34158541 missense probably benign 0.02
IGL03051:Slc35b4 APN 6 34160471 critical splice donor site probably null
R0008:Slc35b4 UTSW 6 34158517 missense probably damaging 1.00
R0008:Slc35b4 UTSW 6 34158517 missense probably damaging 1.00
R1052:Slc35b4 UTSW 6 34161684 missense probably damaging 1.00
R1304:Slc35b4 UTSW 6 34163365 nonsense probably null
R1606:Slc35b4 UTSW 6 34158388 nonsense probably null
R1713:Slc35b4 UTSW 6 34170549 missense probably benign 0.00
R1872:Slc35b4 UTSW 6 34158505 nonsense probably null
R5539:Slc35b4 UTSW 6 34176802 missense probably damaging 0.99
R7339:Slc35b4 UTSW 6 34167656 missense probably damaging 1.00
R7560:Slc35b4 UTSW 6 34163361 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCAGACCTCAGTCCTTCTTG -3'
(R):5'- GGACAATCCGTAGTAATGGGC -3'

Sequencing Primer
(F):5'- CCTCTGTGTACATTAAGGTTCCAATG -3'
(R):5'- CAATCCGTAGTAATGGGCTTAGG -3'
Posted On2018-11-28