Mutagenetix > Incidental Mutation

Incidental Mutation 'R6954:Nup205'

541363

Institutional Source

Beutler Lab

Gene Symbol

Nup205

Ensembl Gene

ENSMUSG00000038759

Gene Name

nucleoporin 205

Synonyms

3830404O05Rik

MMRRC Submission

Accession Numbers

NCBI RefSeq: NM_027513.1; MGI:2141625

Essential gene?

Probably essential (E-score: 0.965) question?

Stock #

R6954 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

35177421-35247596 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 35208109 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 768 (V768E)

Ref Sequence

ENSEMBL: ENSMUSP00000039656 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043815] [ENSMUST00000170234] [ENSMUST00000201374]

AlphaFold

A0A0J9YUD5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000043815
AA Change: V768E

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000039656
Gene: ENSMUSG00000038759
AA Change: V768E

Domain	Start	End	E-Value	Type
low complexity region	2	13	N/A	INTRINSIC
Pfam:Nup192	14	1684	N/A	PFAM
low complexity region	1995	2005	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000170234

SMART Domains

Protein: ENSMUSP00000130033
Gene: ENSMUSG00000038759

Domain	Start	End	E-Value	Type
Pfam:DUF3414	13	322	9.7e-98	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000201374
AA Change: V821E

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000144126
Gene: ENSMUSG00000038759
AA Change: V821E

Domain	Start	End	E-Value	Type
low complexity region	36	50	N/A	INTRINSIC
Pfam:Nup192	67	1737	N/A	PFAM
low complexity region	2048	2058	N/A	INTRINSIC

Meta Mutation Damage Score

0.5851

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.5%

Validation Efficiency

98% (57/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleoporin, which is a subunit of the nuclear pore complex that functions in active transport of proteins, RNAs and ribonucleoprotein particles between the nucleus and cytoplasm. Mutations in this gene are associated with steroid-resistant nephrotic syndrome. [provided by RefSeq, Jul 2016]

Allele List at MGI

All alleles(32) : Targeted(2) Gene trapped(30)

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210407C18Rik	T	A	11: 58,608,488	Y168F	probably benign	Het
4930451I11Rik	A	T	7: 126,830,637		probably null	Het
Alox5	A	C	6: 116,420,280	Y314*	probably null	Het
Ap4e1	T	C	2: 127,064,951	S1044P	probably benign	Het
Ash2l	A	G	8: 25,822,768	V391A	possibly damaging	Het
B4galnt4	A	G	7: 141,067,232	T326A	probably benign	Het
Ccm2	T	A	11: 6,594,239	I345N	probably damaging	Het
Cntnap3	G	A	13: 64,748,559	H1034Y	probably benign	Het
Cpsf1	A	G	15: 76,599,496	L849S	probably damaging	Het
Ctrb1	A	G	8: 111,686,664	S239P	probably damaging	Het
D13Ertd608e	A	G	13: 119,846,130	D20G	possibly damaging	Het
Dennd1b	T	A	1: 139,168,945		probably benign	Het
Dnah17	A	G	11: 118,066,432	I2773T	probably damaging	Het
Eif2b2	T	A	12: 85,226,043	F267L	probably damaging	Het
Fcrls	A	G	3: 87,263,676		probably benign	Het
Furin	G	T	7: 80,396,964	D181E	possibly damaging	Het
Gm29106	T	A	1: 118,200,587	C670S	probably damaging	Het
Gm6309	A	T	5: 146,168,490	D204E	possibly damaging	Het
Hsf2	T	A	10: 57,504,643	I191N	probably damaging	Het
Hspa12a	T	C	19: 58,799,692	D566G	probably benign	Het
Igf1	G	C	10: 87,864,860	V49L	probably damaging	Het
Igfbpl1	C	T	4: 45,826,663	C44Y	probably damaging	Het
Letm1	G	A	5: 33,782,507	R16C	probably benign	Het
Marf1	A	G	16: 14,138,520	V819A	probably damaging	Het
Mfsd4b4	A	T	10: 39,891,952	S428T	probably benign	Het
Myo1d	T	C	11: 80,674,957	I347M	probably benign	Het
Myo9b	A	G	8: 71,290,819	I175V	probably damaging	Het
Naip5	A	T	13: 100,223,414	V438E	probably damaging	Het
Olfr1015	T	A	2: 85,786,382	Y290*	probably null	Het
Olfr731	A	T	14: 50,238,110	Y258*	probably null	Het
Pcdh15	C	T	10: 74,645,989	H1651Y	possibly damaging	Het
Pdgfra	A	T	5: 75,173,394	Q376L	possibly damaging	Het
Pign	T	C	1: 105,553,897	I791M	probably benign	Het
Pik3c2b	T	G	1: 133,066,303	S2A	possibly damaging	Het
Pip5k1a	A	T	3: 95,068,247	I304K	probably damaging	Het
Pkdrej	A	T	15: 85,817,853	L1294*	probably null	Het
Pprc1	T	C	19: 46,064,433	S797P	probably damaging	Het
Prob1	A	G	18: 35,654,268	V311A	probably benign	Het
Prune2	C	A	19: 17,000,021	T40K	probably damaging	Het
Rif1	T	G	2: 52,112,691	D2052E	probably benign	Het
Sall1	A	G	8: 89,032,891	V195A	probably damaging	Het
Scfd1	T	C	12: 51,427,946		probably null	Het
Sidt2	A	T	9: 45,952,850	N123K	probably benign	Het
Slc22a6	G	A	19: 8,622,096	A320T	probably benign	Het
Slc25a10	A	G	11: 120,498,147	H279R	probably benign	Het
Slc35b4	A	G	6: 34,158,621	V252A	probably benign	Het
Slc46a3	T	C	5: 147,886,340	T231A	probably benign	Het
Stxbp1	T	A	2: 32,801,893	H429L	probably damaging	Het
Tas2r134	C	T	2: 51,627,770	T87I	probably benign	Het
Tdpoz2	A	T	3: 93,652,275	L130H	probably damaging	Het
Tmem69	T	C	4: 116,554,724		probably null	Het
Tmppe	G	A	9: 114,405,523	V297I	probably benign	Het
Ung	G	T	5: 114,131,337	A37S	probably benign	Het
Vdac1	T	C	11: 52,386,373	Y237H	probably damaging	Het
Vgll4	T	C	6: 114,921,367	Y11C	probably damaging	Het
Vmn1r24	A	G	6: 57,956,452	I27T	probably benign	Het
Zfp280b	T	A	10: 76,039,688	M467K	probably benign	Het
Zkscan4	A	G	13: 21,484,365	I329V	probably damaging	Het

Other mutations in Nup205

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00484:Nup205	APN	6	35214802	missense	probably damaging	1.00
IGL01086:Nup205	APN	6	35208936	splice site	probably benign
IGL01138:Nup205	APN	6	35208084	nonsense	probably null
IGL01333:Nup205	APN	6	35241063	missense	probably benign
IGL01399:Nup205	APN	6	35219689	missense	possibly damaging	0.80
IGL01466:Nup205	APN	6	35199959	missense	probably benign	0.08
IGL01913:Nup205	APN	6	35227430	missense	probably benign	0.10
IGL02159:Nup205	APN	6	35189178	missense	probably damaging	1.00
IGL02442:Nup205	APN	6	35190068	missense	probably benign	0.01
IGL02447:Nup205	APN	6	35227576	splice site	probably null
IGL02558:Nup205	APN	6	35189924	missense	probably damaging	1.00
IGL03306:Nup205	APN	6	35208169	missense	probably damaging	0.98
IGL03328:Nup205	APN	6	35232414	missense	probably damaging	0.99
Figaro	UTSW	6	35196714	splice site	probably null
Marcellina	UTSW	6	35183969	missense	probably damaging	1.00
Spirit	UTSW	6	35232408	missense	probably damaging	0.98
Susanna	UTSW	6	35208109	missense	possibly damaging	0.94
voyager	UTSW	6	35189885	missense	possibly damaging	0.80
BB007:Nup205	UTSW	6	35194576	missense	probably damaging	0.98
BB017:Nup205	UTSW	6	35194576	missense	probably damaging	0.98
P0012:Nup205	UTSW	6	35196543	missense	possibly damaging	0.90
R0102:Nup205	UTSW	6	35225780	splice site	probably benign
R0102:Nup205	UTSW	6	35225780	splice site	probably benign
R0362:Nup205	UTSW	6	35196714	splice site	probably null
R0374:Nup205	UTSW	6	35208837	missense	probably damaging	1.00
R0415:Nup205	UTSW	6	35214634	splice site	probably benign
R0427:Nup205	UTSW	6	35194463	missense	probably benign	0.01
R0543:Nup205	UTSW	6	35198969	missense	probably benign
R0611:Nup205	UTSW	6	35225968	missense	probably null	1.00
R0761:Nup205	UTSW	6	35196428	splice site	probably benign
R0828:Nup205	UTSW	6	35194566	missense	probably benign
R0906:Nup205	UTSW	6	35236892	missense	probably damaging	1.00
R1023:Nup205	UTSW	6	35234706	missense	probably damaging	0.98
R1033:Nup205	UTSW	6	35227442	missense	probably benign
R1375:Nup205	UTSW	6	35200071	splice site	probably benign
R1447:Nup205	UTSW	6	35215185	missense	probably benign	0.00
R1468:Nup205	UTSW	6	35225982	critical splice donor site	probably null
R1468:Nup205	UTSW	6	35225982	critical splice donor site	probably null
R1625:Nup205	UTSW	6	35191943	missense	probably benign	0.31
R1652:Nup205	UTSW	6	35238966	missense	probably benign
R1659:Nup205	UTSW	6	35234788	missense	probably benign	0.02
R1693:Nup205	UTSW	6	35210971	missense	probably benign	0.05
R1769:Nup205	UTSW	6	35205431	missense	probably damaging	1.00
R1839:Nup205	UTSW	6	35219714	missense	probably benign	0.00
R1959:Nup205	UTSW	6	35233366	missense	probably benign	0.16
R2051:Nup205	UTSW	6	35230516	missense	probably benign	0.29
R2267:Nup205	UTSW	6	35241349	missense	possibly damaging	0.67
R2401:Nup205	UTSW	6	35208134	nonsense	probably null
R3697:Nup205	UTSW	6	35188711	missense	probably benign	0.15
R3938:Nup205	UTSW	6	35219742	missense	probably damaging	1.00
R4074:Nup205	UTSW	6	35192040	critical splice donor site	probably null
R4117:Nup205	UTSW	6	35241012	nonsense	probably null
R4364:Nup205	UTSW	6	35192027	missense	probably benign	0.38
R4366:Nup205	UTSW	6	35192027	missense	probably benign	0.38
R4594:Nup205	UTSW	6	35196489	missense	probably benign	0.00
R4706:Nup205	UTSW	6	35202008	missense	probably damaging	1.00
R4787:Nup205	UTSW	6	35202061	missense	probably damaging	1.00
R4849:Nup205	UTSW	6	35230570	missense	possibly damaging	0.90
R4850:Nup205	UTSW	6	35230530	missense	probably benign	0.16
R4943:Nup205	UTSW	6	35224639	missense	probably damaging	1.00
R4966:Nup205	UTSW	6	35243849	missense	probably benign	0.00
R5138:Nup205	UTSW	6	35225866	missense	probably damaging	1.00
R5251:Nup205	UTSW	6	35196482	splice site	probably null
R5444:Nup205	UTSW	6	35189189	missense	probably damaging	0.98
R5760:Nup205	UTSW	6	35247343	missense	probably damaging	1.00
R5762:Nup205	UTSW	6	35227680	missense	probably damaging	1.00
R5762:Nup205	UTSW	6	35230548	missense	probably damaging	0.96
R5941:Nup205	UTSW	6	35232408	missense	probably damaging	0.98
R5969:Nup205	UTSW	6	35177578	unclassified	probably benign
R6003:Nup205	UTSW	6	35212816	missense	probably benign
R6178:Nup205	UTSW	6	35243843	missense	possibly damaging	0.85
R6315:Nup205	UTSW	6	35236869	missense	probably damaging	1.00
R6392:Nup205	UTSW	6	35189885	missense	possibly damaging	0.80
R6710:Nup205	UTSW	6	35247373	missense	probably benign	0.00
R7022:Nup205	UTSW	6	35243936	missense	probably benign	0.45
R7041:Nup205	UTSW	6	35224535	missense	possibly damaging	0.49
R7052:Nup205	UTSW	6	35215142	missense	possibly damaging	0.81
R7310:Nup205	UTSW	6	35225969	missense	possibly damaging	0.78
R7363:Nup205	UTSW	6	35232573	missense	probably benign	0.28
R7399:Nup205	UTSW	6	35214676	missense	probably damaging	0.99
R7428:Nup205	UTSW	6	35227559	missense	probably damaging	1.00
R7553:Nup205	UTSW	6	35201999	missense	probably damaging	1.00
R7665:Nup205	UTSW	6	35177620	missense	possibly damaging	0.46
R7841:Nup205	UTSW	6	35247437	missense	unknown
R7930:Nup205	UTSW	6	35194576	missense	probably damaging	0.98
R7973:Nup205	UTSW	6	35245339	missense	probably benign
R7976:Nup205	UTSW	6	35198953	missense	probably damaging	1.00
R8073:Nup205	UTSW	6	35202169	critical splice donor site	probably null
R8080:Nup205	UTSW	6	35227376	missense	probably damaging	1.00
R8118:Nup205	UTSW	6	35230516	missense	probably benign	0.29
R8213:Nup205	UTSW	6	35225203	missense	probably benign	0.26
R8237:Nup205	UTSW	6	35227503	missense	possibly damaging	0.89
R8408:Nup205	UTSW	6	35225247	missense	probably damaging	1.00
R8807:Nup205	UTSW	6	35183969	missense	probably damaging	1.00
R8812:Nup205	UTSW	6	35214334	missense	probably damaging	1.00
R9061:Nup205	UTSW	6	35219873	intron	probably benign
R9261:Nup205	UTSW	6	35199857	missense	probably benign	0.00
R9403:Nup205	UTSW	6	35199974	missense	probably benign	0.45
R9648:Nup205	UTSW	6	35225811	missense	probably benign	0.00
R9744:Nup205	UTSW	6	35232575	missense	probably damaging	0.99
R9800:Nup205	UTSW	6	35186533	missense	possibly damaging	0.85
Z1177:Nup205	UTSW	6	35177605	missense	unknown
Z1177:Nup205	UTSW	6	35208793	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- CCTTTGGCAAAATGAAACAAGGTG -3'
(R):5'- TTGATGCGCACATGAGAGCC -3'

Sequencing Primer
(F):5'- CAAGGTGAATTAAGATTGTGTTGC -3'
(R):5'- AGAACCCAGACATCCTATTTTCTC -3'

Posted On

2018-11-28