Incidental Mutation 'R6954:Sidt2'
ID541373
Institutional Source Beutler Lab
Gene Symbol Sidt2
Ensembl Gene ENSMUSG00000034908
Gene NameSID1 transmembrane family, member 2
SynonymsCGI-40
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.198) question?
Stock #R6954 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location45937857-45955258 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45952850 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 123 (N123K)
Ref Sequence ENSEMBL: ENSMUSP00000124750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038488] [ENSMUST00000114573] [ENSMUST00000160138] [ENSMUST00000162072] [ENSMUST00000162379] [ENSMUST00000162529]
Predicted Effect probably benign
Transcript: ENSMUST00000038488
AA Change: N123K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000044290
Gene: ENSMUSG00000034908
AA Change: N123K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:SID-1_RNA_chan 169 832 8.5e-214 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114573
AA Change: N123K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000110220
Gene: ENSMUSG00000034908
AA Change: N123K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:SID-1_RNA_chan 169 853 9e-290 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160138
SMART Domains Protein: ENSMUSP00000124945
Gene: ENSMUSG00000034908

DomainStartEndE-ValueType
low complexity region 131 142 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161042
SMART Domains Protein: ENSMUSP00000124577
Gene: ENSMUSG00000034908

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161606
SMART Domains Protein: ENSMUSP00000125660
Gene: ENSMUSG00000034908

DomainStartEndE-ValueType
Pfam:SID-1_RNA_chan 1 221 4.7e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162072
AA Change: N123K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000124750
Gene: ENSMUSG00000034908
AA Change: N123K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:SID-1_RNA_chan 169 338 2.3e-34 PFAM
low complexity region 452 463 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162379
SMART Domains Protein: ENSMUSP00000124503
Gene: ENSMUSG00000034908

DomainStartEndE-ValueType
Pfam:SID-1_RNA_chan 1 135 3.3e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162529
SMART Domains Protein: ENSMUSP00000125060
Gene: ENSMUSG00000034908

DomainStartEndE-ValueType
Pfam:SID-1_RNA_chan 1 135 9.2e-20 PFAM
low complexity region 202 213 N/A INTRINSIC
Meta Mutation Damage Score 0.0697 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 98% (57/58)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele exhibit male-specific decreased body weight and size, impaired glucose tolerance, increased serum glucose, decreased serum insulin and decreased insule granule release from beta cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik T A 11: 58,608,488 Y168F probably benign Het
4930451I11Rik A T 7: 126,830,637 probably null Het
Alox5 A C 6: 116,420,280 Y314* probably null Het
Ap4e1 T C 2: 127,064,951 S1044P probably benign Het
Ash2l A G 8: 25,822,768 V391A possibly damaging Het
B4galnt4 A G 7: 141,067,232 T326A probably benign Het
Ccm2 T A 11: 6,594,239 I345N probably damaging Het
Cntnap3 G A 13: 64,748,559 H1034Y probably benign Het
Cpsf1 A G 15: 76,599,496 L849S probably damaging Het
Ctrb1 A G 8: 111,686,664 S239P probably damaging Het
D13Ertd608e A G 13: 119,846,130 D20G possibly damaging Het
Dennd1b T A 1: 139,168,945 probably benign Het
Dnah17 A G 11: 118,066,432 I2773T probably damaging Het
Eif2b2 T A 12: 85,226,043 F267L probably damaging Het
Fcrls A G 3: 87,263,676 probably benign Het
Furin G T 7: 80,396,964 D181E possibly damaging Het
Gm29106 T A 1: 118,200,587 C670S probably damaging Het
Gm6309 A T 5: 146,168,490 D204E possibly damaging Het
Hsf2 T A 10: 57,504,643 I191N probably damaging Het
Hspa12a T C 19: 58,799,692 D566G probably benign Het
Igf1 G C 10: 87,864,860 V49L probably damaging Het
Igfbpl1 C T 4: 45,826,663 C44Y probably damaging Het
Letm1 G A 5: 33,782,507 R16C probably benign Het
Marf1 A G 16: 14,138,520 V819A probably damaging Het
Mfsd4b4 A T 10: 39,891,952 S428T probably benign Het
Myo1d T C 11: 80,674,957 I347M probably benign Het
Myo9b A G 8: 71,290,819 I175V probably damaging Het
Naip5 A T 13: 100,223,414 V438E probably damaging Het
Nup205 T A 6: 35,208,109 V768E possibly damaging Het
Olfr1015 T A 2: 85,786,382 Y290* probably null Het
Olfr731 A T 14: 50,238,110 Y258* probably null Het
Pcdh15 C T 10: 74,645,989 H1651Y possibly damaging Het
Pdgfra A T 5: 75,173,394 Q376L possibly damaging Het
Pign T C 1: 105,553,897 I791M probably benign Het
Pik3c2b T G 1: 133,066,303 S2A possibly damaging Het
Pip5k1a A T 3: 95,068,247 I304K probably damaging Het
Pkdrej A T 15: 85,817,853 L1294* probably null Het
Pprc1 T C 19: 46,064,433 S797P probably damaging Het
Prob1 A G 18: 35,654,268 V311A probably benign Het
Prune2 C A 19: 17,000,021 T40K probably damaging Het
Rif1 T G 2: 52,112,691 D2052E probably benign Het
Sall1 A G 8: 89,032,891 V195A probably damaging Het
Scfd1 T C 12: 51,427,946 probably null Het
Slc22a6 G A 19: 8,622,096 A320T probably benign Het
Slc25a10 A G 11: 120,498,147 H279R probably benign Het
Slc35b4 A G 6: 34,158,621 V252A probably benign Het
Slc46a3 T C 5: 147,886,340 T231A probably benign Het
Stxbp1 T A 2: 32,801,893 H429L probably damaging Het
Tas2r134 C T 2: 51,627,770 T87I probably benign Het
Tdpoz2 A T 3: 93,652,275 L130H probably damaging Het
Tmem69 T C 4: 116,554,724 probably null Het
Tmppe G A 9: 114,405,523 V297I probably benign Het
Ung G T 5: 114,131,337 A37S probably benign Het
Vdac1 T C 11: 52,386,373 Y237H probably damaging Het
Vgll4 T C 6: 114,921,367 Y11C probably damaging Het
Vmn1r24 A G 6: 57,956,452 I27T probably benign Het
Zfp280b T A 10: 76,039,688 M467K probably benign Het
Zkscan4 A G 13: 21,484,365 I329V probably damaging Het
Other mutations in Sidt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Sidt2 APN 9 45942236 missense possibly damaging 0.84
IGL00586:Sidt2 APN 9 45943052 missense possibly damaging 0.78
IGL00786:Sidt2 APN 9 45949803 missense possibly damaging 0.69
IGL01069:Sidt2 APN 9 45943077 missense possibly damaging 0.73
IGL01160:Sidt2 APN 9 45942726 missense probably damaging 1.00
IGL01474:Sidt2 APN 9 45946982 critical splice donor site probably null
IGL02068:Sidt2 APN 9 45945664 critical splice donor site probably null
IGL02171:Sidt2 APN 9 45952770 missense possibly damaging 0.81
IGL02312:Sidt2 APN 9 45947001 missense probably benign 0.27
IGL02344:Sidt2 APN 9 45945292 missense probably null 1.00
IGL03030:Sidt2 APN 9 45939505 missense probably damaging 1.00
IGL03062:Sidt2 APN 9 45942683 critical splice donor site probably null
R0157:Sidt2 UTSW 9 45939267 missense probably damaging 1.00
R0330:Sidt2 UTSW 9 45954902 missense probably benign 0.09
R0549:Sidt2 UTSW 9 45953119 splice site probably null
R0714:Sidt2 UTSW 9 45947060 splice site probably benign
R1241:Sidt2 UTSW 9 45945704 missense probably damaging 0.97
R1511:Sidt2 UTSW 9 45950089 missense probably damaging 1.00
R1558:Sidt2 UTSW 9 45951800 missense probably damaging 1.00
R1677:Sidt2 UTSW 9 45953219 missense probably benign 0.01
R2152:Sidt2 UTSW 9 45945340 missense probably damaging 1.00
R2153:Sidt2 UTSW 9 45945340 missense probably damaging 1.00
R2154:Sidt2 UTSW 9 45945340 missense probably damaging 1.00
R4210:Sidt2 UTSW 9 45942775 missense probably benign 0.00
R4349:Sidt2 UTSW 9 45945713 missense possibly damaging 0.94
R4855:Sidt2 UTSW 9 45952029 missense probably benign
R5069:Sidt2 UTSW 9 45939461 unclassified probably null
R5175:Sidt2 UTSW 9 45951788 missense probably damaging 1.00
R5276:Sidt2 UTSW 9 45954777 missense probably damaging 0.97
R5544:Sidt2 UTSW 9 45944455 missense probably damaging 1.00
R5805:Sidt2 UTSW 9 45942199 missense probably damaging 0.97
R5927:Sidt2 UTSW 9 45944454 missense probably damaging 1.00
R7060:Sidt2 UTSW 9 45953246 missense possibly damaging 0.91
R7117:Sidt2 UTSW 9 45953219 missense probably benign 0.01
R7207:Sidt2 UTSW 9 45945151 missense probably damaging 1.00
R7317:Sidt2 UTSW 9 45943690 nonsense probably null
X0026:Sidt2 UTSW 9 45939299 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGCTGCAGTGGTATTAAAAG -3'
(R):5'- GCAGGAGGGTAACTTTGTCAG -3'

Sequencing Primer
(F):5'- CTCTCCAGTCCTACAGGGAAGAGAG -3'
(R):5'- TAACTTTGTCAGCCCAGGGAATG -3'
Posted On2018-11-28