Incidental Mutation 'R6954:Tmppe'
ID 541374
Institutional Source Beutler Lab
Gene Symbol Tmppe
Ensembl Gene ENSMUSG00000079260
Gene Name transmembrane protein with metallophosphoesterase domain
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.595) question?
Stock # R6954 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 114401105-114407276 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 114405523 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 297 (V297I)
Ref Sequence ENSEMBL: ENSMUSP00000107451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063042] [ENSMUST00000111820] [ENSMUST00000217583]
AlphaFold D3Z286
Predicted Effect probably benign
Transcript: ENSMUST00000063042
SMART Domains Protein: ENSMUSP00000055803
Gene: ENSMUSG00000045594

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Glyco_hydro_35 41 358 2.5e-129 PFAM
Pfam:Glyco_hydro_42 56 216 9.4e-15 PFAM
Pfam:BetaGal_dom4_5 531 623 4.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111820
AA Change: V297I

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000107451
Gene: ENSMUSG00000079260
AA Change: V297I

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
transmembrane domain 42 64 N/A INTRINSIC
transmembrane domain 84 106 N/A INTRINSIC
transmembrane domain 116 138 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:Metallophos 207 389 5.1e-13 PFAM
Pfam:Metallophos_2 207 421 7.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217583
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik T A 11: 58,608,488 Y168F probably benign Het
4930451I11Rik A T 7: 126,830,637 probably null Het
Alox5 A C 6: 116,420,280 Y314* probably null Het
Ap4e1 T C 2: 127,064,951 S1044P probably benign Het
Ash2l A G 8: 25,822,768 V391A possibly damaging Het
B4galnt4 A G 7: 141,067,232 T326A probably benign Het
Ccm2 T A 11: 6,594,239 I345N probably damaging Het
Cntnap3 G A 13: 64,748,559 H1034Y probably benign Het
Cpsf1 A G 15: 76,599,496 L849S probably damaging Het
Ctrb1 A G 8: 111,686,664 S239P probably damaging Het
D13Ertd608e A G 13: 119,846,130 D20G possibly damaging Het
Dennd1b T A 1: 139,168,945 probably benign Het
Dnah17 A G 11: 118,066,432 I2773T probably damaging Het
Eif2b2 T A 12: 85,226,043 F267L probably damaging Het
Fcrls A G 3: 87,263,676 probably benign Het
Furin G T 7: 80,396,964 D181E possibly damaging Het
Gm29106 T A 1: 118,200,587 C670S probably damaging Het
Gm6309 A T 5: 146,168,490 D204E possibly damaging Het
Hsf2 T A 10: 57,504,643 I191N probably damaging Het
Hspa12a T C 19: 58,799,692 D566G probably benign Het
Igf1 G C 10: 87,864,860 V49L probably damaging Het
Igfbpl1 C T 4: 45,826,663 C44Y probably damaging Het
Letm1 G A 5: 33,782,507 R16C probably benign Het
Marf1 A G 16: 14,138,520 V819A probably damaging Het
Mfsd4b4 A T 10: 39,891,952 S428T probably benign Het
Myo1d T C 11: 80,674,957 I347M probably benign Het
Myo9b A G 8: 71,290,819 I175V probably damaging Het
Naip5 A T 13: 100,223,414 V438E probably damaging Het
Nup205 T A 6: 35,208,109 V768E possibly damaging Het
Olfr1015 T A 2: 85,786,382 Y290* probably null Het
Olfr731 A T 14: 50,238,110 Y258* probably null Het
Pcdh15 C T 10: 74,645,989 H1651Y possibly damaging Het
Pdgfra A T 5: 75,173,394 Q376L possibly damaging Het
Pign T C 1: 105,553,897 I791M probably benign Het
Pik3c2b T G 1: 133,066,303 S2A possibly damaging Het
Pip5k1a A T 3: 95,068,247 I304K probably damaging Het
Pkdrej A T 15: 85,817,853 L1294* probably null Het
Pprc1 T C 19: 46,064,433 S797P probably damaging Het
Prob1 A G 18: 35,654,268 V311A probably benign Het
Prune2 C A 19: 17,000,021 T40K probably damaging Het
Rif1 T G 2: 52,112,691 D2052E probably benign Het
Sall1 A G 8: 89,032,891 V195A probably damaging Het
Scfd1 T C 12: 51,427,946 probably null Het
Sidt2 A T 9: 45,952,850 N123K probably benign Het
Slc22a6 G A 19: 8,622,096 A320T probably benign Het
Slc25a10 A G 11: 120,498,147 H279R probably benign Het
Slc35b4 A G 6: 34,158,621 V252A probably benign Het
Slc46a3 T C 5: 147,886,340 T231A probably benign Het
Stxbp1 T A 2: 32,801,893 H429L probably damaging Het
Tas2r134 C T 2: 51,627,770 T87I probably benign Het
Tdpoz2 A T 3: 93,652,275 L130H probably damaging Het
Tmem69 T C 4: 116,554,724 probably null Het
Ung G T 5: 114,131,337 A37S probably benign Het
Vdac1 T C 11: 52,386,373 Y237H probably damaging Het
Vgll4 T C 6: 114,921,367 Y11C probably damaging Het
Vmn1r24 A G 6: 57,956,452 I27T probably benign Het
Zfp280b T A 10: 76,039,688 M467K probably benign Het
Zkscan4 A G 13: 21,484,365 I329V probably damaging Het
Other mutations in Tmppe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01823:Tmppe APN 9 114405107 missense probably benign 0.03
IGL02274:Tmppe APN 9 114405431 missense probably benign
IGL02349:Tmppe APN 9 114405200 missense probably benign
R0201:Tmppe UTSW 9 114404639 frame shift probably null
R1668:Tmppe UTSW 9 114404900 missense possibly damaging 0.89
R2206:Tmppe UTSW 9 114405572 missense probably benign
R5026:Tmppe UTSW 9 114405819 missense possibly damaging 0.90
R5054:Tmppe UTSW 9 114405958 missense probably benign 0.41
R5118:Tmppe UTSW 9 114405481 missense probably benign 0.02
R5623:Tmppe UTSW 9 114405896 missense possibly damaging 0.59
R6307:Tmppe UTSW 9 114404744 missense probably benign 0.00
R6502:Tmppe UTSW 9 114405652 missense probably damaging 1.00
R6597:Tmppe UTSW 9 114405244 missense probably benign 0.00
R6627:Tmppe UTSW 9 114405485 missense probably damaging 1.00
R6888:Tmppe UTSW 9 114404701 missense probably damaging 1.00
R7032:Tmppe UTSW 9 114405790 missense probably damaging 1.00
R7141:Tmppe UTSW 9 114404968 missense probably benign 0.00
R7642:Tmppe UTSW 9 114404794 missense possibly damaging 0.95
R8894:Tmppe UTSW 9 114401192 start gained probably benign
R9101:Tmppe UTSW 9 114405241 missense probably damaging 0.99
Z1088:Tmppe UTSW 9 114405077 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACATCACAGTGATCGTGGGC -3'
(R):5'- AGGATCAAGTTTATATCTGGCCG -3'

Sequencing Primer
(F):5'- GCGACCTCTCCGACTCG -3'
(R):5'- CCAGTAAGATGGTGGCATCGTC -3'
Posted On 2018-11-28